Engineering van SARS-CoV-2 met behulp van een omgekeerd genetisch systeem

Deel deze pagina, de waarheid is in ieders belang.

Xuping Xie # 1Kumari G Lokugamage # 2Xianwen Zhang # 1Michelle N Wu 2Antonio E Muruato 1 2Vineet D Menachery 3 4 5Pei-Yong Shio 6 7 8 9 10

Abstract

Omgekeerde genetische systemen zijn een cruciaal hulpmiddel voor het bestuderen van virussen en het identificeren van tegenmaatregelen. Als reactie op de aanhoudende COVID-19-pandemie hebben we onlangs een infectieuze complementaire DNA-kloon (cDNA) ontwikkeld voor het ernstige acute respiratoire syndroom coronavirus 2 (SARS-CoV-2). Het omgekeerde genetische systeem kan worden gebruikt om virussen met gewenste mutaties snel te manipuleren om het virus in vitro en in vivo te bestuderen. Virussen kunnen ook worden ontworpen voor de ontwikkeling van levende verzwakte vaccins en worden gemanipuleerd met reportergenen om serodiagnose, vaccinevaluatie en antivirale screening te vergemakkelijken. Het omgekeerde genetische systeem van SARS-CoV-2 zal dus op grote schaal worden gebruikt voor zowel fundamenteel als translationeel onderzoek. Vanwege de grote omvang van het coronavirusgenoom (~ 30.000 nucleotiden lang) en verschillende giftige genomische elementen, manipulatie van het omgekeerde genetische systeem van SARS-COV-2 is geen triviale taak en vereist geavanceerde methoden. Hier beschrijven we de technische details van het engineeren van recombinant SARS-CoV-2. Over het algemeen omvat het proces zes stappen: (i) zeven plasmiden bereiden die SARS-CoV-2-cDNA-fragment(en) bevatten, (ii) hoogwaardige DNA-fragmenten bereiden door middel van restrictie-enzymdigestie van de zeven plasmiden, (iii) de zeven samenstellen cDNA-fragmenten in een cDNA met de lengte van het genoom, (iv) in vitro transcriberen RNA van het cDNA met de lengte van het genoom, (iv) het elektroporeren van het RNA met de lengte van het genoom in cellen om recombinante virussen terug te winnen en (vi) de geredde virussen te karakteriseren. Dit protocol stelt onderzoekers met verschillende onderzoeksachtergronden in staat om het gebruik van het omgekeerde genetische systeem onder de knie te krijgen en zo het COVID-19-onderzoek te versnellen.

Invoering

De opkomst van SARS-CoV-2 eind 2019 leidde tot een wereldwijde pandemie die de wereldeconomie en de volksgezondheid blijft bedreigen 1 . Om dit nieuw opgekomen coronavirus te bestrijden, hebben we een omgekeerd genetisch systeem ontwikkeld om recombinante virussen te genereren om de biologie van SARS-CoV-2 te karakteriseren en vaccins en therapieën te ontwikkelen (Fig. 1 ) 2 , 3 , 4 . De SARS-CoV-2 infectieuze complementaire DNA-kloon (cDNA) maakt gebruik van een in vitro ligatiebenadering die werd ontwikkeld met andere coronavirussen, waaronder het overdraagbare gastro-enteritisvirus (TGEV), het muizenhepatitisvirus (MHV) en het oorspronkelijke coronavirus met ernstige acute respiratoire syndroom ( SARS-CoV) 5 , 6 ,7 . Onze infectieuze cDNA-kloon-afgeleide SARS-CoV-2 (icSARS-CoV-2) recapituleert de plaquemorfologie, het virale RNA-profiel en de replicatiekinetiek van het oorspronkelijke klinische isolaat (stam SARS-CoV-2 WA1) 8 . Daarnaast hebben we een reportervirus gegenereerd dat stabiel een fluorescerend reportereiwit (mNeonGreen) en nanoluciferase (Nanoluc) tot expressie brengt om de ontdekking van therapeutische middelen en de evaluatie van vaccins te vergemakkelijken 2 , 3 , 4 . De infectieuze cDNA-kloon is ook gebruikt om de virale elementen te bestuderen die belangrijk zijn voor de pathogenese van SARS-CoV-2 9 , 10. Samen biedt dit omgekeerde genetische systeem een ​​cruciaal hulpmiddel bij de studie van SARS-CoV-2 en voor de ontwikkeling van tegenmaatregelen. In dit rapport beschrijven we de technische informatie en gedetailleerde protocollen voor het gebruik van deze reverse genetische tool.

Figuur 1
Fig. 1: Overzicht van SARS-CoV-2 omgekeerd genetisch systeem.

Ontwikkeling van het protocol

Met de snelle verspreiding van SARS-CoV-2 hebben onderzoekers over de hele wereld pogingen ondernomen om te reageren op de COVID-19-pandemie. De technische vereiste voor de assemblage van het volledige genoom-coronavirus-cDNA is een uitdaging vanwege de grote genomische grootte (~ 30.000 nucleotiden), toxische genomische regio’s en problemen met mutaties en deleties in de virale sequentie 11 .

Als reactie hierop ontwikkelde onze groep een omgekeerd genetisch systeem dat een snelle synthese van wildtype, mutante en reporter SARS-CoV-2-stammen mogelijk maakt om virale infectie, transmissie, pathogenese, therapieën en vaccins te bestuderen 3 . Het past dezelfde principes toe van infectieuze klonen die zijn ontwikkeld voor TGEV, MHV, SARS-CoV, Middle East Respiratory Syndrome (MERS)-CoV en verschillende vleermuiscoronavirussen 5 , 6 , 7 , 12 , 13 , 14 , 15 . In het kort, een aaneengesloten panel van zeven cDNA-fragmenten werd ontworpen om het volledige genoom van SARS-CoV-2 te omspannen en werd afzonderlijk in plasmiden gekloond met behulp van type IIS-restrictie-enzymplaatsen (Fig. 1). De restrictie-enzymen van het type IIS werden gekozen voor klonering omdat ze asymmetrische DNA-sequenties herkennen en unieke samenhangende overhangen genereren die zorgen voor één directionele, naadloze assemblage van de zeven DNA-fragmenten in het cDNA met de lengte van het genoom. Het geassembleerde cDNA met de lengte van het genoom werd gebruikt als een matrijs voor in vitro transcriptie. Het resulterende virale RNA van genoomlengte werd vervolgens in cellen geëlektroporeerd om recombinant SARS-CoV-2 te winnen. We hebben deze methode oorspronkelijk beschreven in ons ondersteunende Cell Host & Microbe paper, waaruit bleek dat het cDNA met het volledige genoom zeer besmettelijk was na elektroporatie in cellen. Het van infectieuze kloon afgeleide SARS-CoV-2 (icSARS-CoV-2) vertoonde vergelijkbare plaquemorfologie, viraal RNA-profiel en replicatiekinetiek als een klinisch isolaat. Daarnaast hebben we een stabiele mNeonGreen SARS-CoV-2 (icSARS-CoV-2-mNG) gegenereerd die met succes werd gebruikt om de antivirale activiteiten van interferon en vaccinontwikkeling te evalueren 2 , 3 , 16 , 17 , 18 . In dit protocolartikel geven we meer gedetailleerde informatie over het gebruik van deze methode, inclusief informatie over het oplossen van problemen.

Overzicht van de procedure

Fase 1 van de procedure (stappen 1-33) is de voorbereiding van de zeven plasmiden die SARS-CoV-2-fragmenten F1-F7 bevatten. De plasmiden moeten worden gevalideerd door digestie met restrictie-enzymen en Sanger-sequencing om introductie van ongewenste mutaties in de plasmiden uit te sluiten voordat het SARS-CoV-2-DNA van volledige lengte wordt samengesteld. Fase 2 (stappen 34-45) omvat de bereiding van hoogwaardige DNA-fragmenten voor stroomafwaartse experimenten door restrictie-enzymdigestie van de Maxiprep-plasmiden. Fase 3 (stappen 46-89) omvat het in vitro samenstellen van de zeven DNA-fragmenten tot een SARS-CoV-2-DNA van volledige lengte met behulp van een T4-DNA-ligase. Twee afzonderlijke ligatiestappen verhogen de ligatie-efficiëntie van het DNA van volledige lengte en vermijden niet-specifieke ligatie tussen fragmenten F3 en F7. Nadien, het ligatieproduct van volledige lengte wordt onmiddellijk gezuiverd door fenol-chloroformextractie en isopropanolprecipitatie. Fase 4 (stappen 90-96) is in vitro transcriptie van RNA van volledige lengte en N-gen-RNA. Fase 5 (stap 97) omvat het herstel van het SARS-CoV-2-recombinante virus uit celkweek via RNA-elektroporatie. Er kunnen twee verschillende methoden worden gebruikt voor elektroporatie, waarbij alleen Vero E6-cellen of BHK-21- en VeroE6-cellen worden gebruikt. Fase 6 (stappen 98-108) omvat Sanger-sequencing van het hele genoom van het virus om de volledige virale genoomsequentie te verifiëren. De procedures van de fasen 1-4 kunnen worden uitgevoerd in een algemeen laboratorium. De procedures van fase 5 en 6 die betrekking hebben op het manipuleren van de SARS-CoV-2, moeten worden uitgevoerd in een faciliteit voor bioveiligheidslaboratoriumniveau 3 (BSL-3). Fase 4 (stappen 90-96) is in vitro transcriptie van RNA van volledige lengte en N-gen-RNA. Fase 5 (stap 97) omvat het herstel van het SARS-CoV-2-recombinante virus uit celkweek via RNA-elektroporatie. Er kunnen twee verschillende methoden worden gebruikt voor elektroporatie, waarbij alleen Vero E6-cellen of BHK-21- en VeroE6-cellen worden gebruikt. Fase 6 (stappen 98-108) omvat Sanger-sequencing van het hele genoom van het virus om de volledige virale genoomsequentie te verifiëren. De procedures van de fasen 1-4 kunnen worden uitgevoerd in een algemeen laboratorium. De procedures van fase 5 en 6 die betrekking hebben op het manipuleren van de SARS-CoV-2, moeten worden uitgevoerd in een faciliteit voor bioveiligheidslaboratoriumniveau 3 (BSL-3). Fase 4 (stappen 90-96) is in vitro transcriptie van RNA van volledige lengte en N-gen-RNA. Fase 5 (stap 97) omvat het herstel van het SARS-CoV-2-recombinante virus uit celkweek via RNA-elektroporatie. Er kunnen twee verschillende methoden worden gebruikt voor elektroporatie, waarbij alleen Vero E6-cellen of BHK-21- en VeroE6-cellen worden gebruikt. Fase 6 (stappen 98-108) omvat Sanger-sequencing van het hele genoom van het virus om de volledige virale genoomsequentie te verifiëren. De procedures van de fasen 1-4 kunnen worden uitgevoerd in een algemeen laboratorium. De procedures van fase 5 en 6 die betrekking hebben op het manipuleren van de SARS-CoV-2, moeten worden uitgevoerd in een faciliteit voor bioveiligheidslaboratoriumniveau 3 (BSL-3). met alleen Vero E6-cellen of BHK-21- en VeroE6-cellen. Fase 6 (stappen 98-108) omvat Sanger-sequencing van het hele genoom van het virus om de volledige virale genoomsequentie te verifiëren. De procedures van de fasen 1-4 kunnen worden uitgevoerd in een algemeen laboratorium. De procedures van fase 5 en 6 die betrekking hebben op het manipuleren van de SARS-CoV-2, moeten worden uitgevoerd in een faciliteit voor bioveiligheidslaboratoriumniveau 3 (BSL-3). met alleen Vero E6-cellen of BHK-21- en VeroE6-cellen. Fase 6 (stappen 98-108) omvat Sanger-sequencing van het hele genoom van het virus om de volledige virale genoomsequentie te verifiëren. De procedures van de fasen 1-4 kunnen worden uitgevoerd in een algemeen laboratorium. De procedures van fase 5 en 6 die betrekking hebben op het manipuleren van de SARS-CoV-2, moeten worden uitgevoerd in een faciliteit voor bioveiligheidslaboratoriumniveau 3 (BSL-3).

alternatieve methoden

Onze benadering met zeven cDNA-fragmenten heeft verschillende belangrijke voordelen ten opzichte van alternatieve methoden, waaronder bacteriële kunstmatige chromosomen, een vacciniavirus en op gistrecombinatie gebaseerde assemblage 11 , 19. Ten eerste maakt het een snelle generatie van mutant- en reportervirussen mogelijk door manipulatie van een kleiner plasmide (dwz het plasmide dat het beoogde mutatiefragment bevat), waardoor het risico wordt verminderd dat mutaties buiten het doelwit of deleties die per ongeluk in het recombinante virus worden opgenomen. Ten tweede maakt deze benadering gelijktijdige manipulatie van meerdere mutaties van verschillende cDNA-fragmenten mogelijk. Meer dan één mutatie van verschillende cDNA-fragmenten kan parallel worden gemanipuleerd om combinatorische mutante virussen te maken. Een dergelijke flexibiliteit is belangrijk bij het karakteriseren van een gecombineerd effect van meerdere virale elementen op de immuunrespons van de gastheer of bij het ontwikkelen van een levend verzwakt vaccinplatform, waarvoor vaak meerdere mutatieplaatsen tegelijk moeten worden onderzocht 20 , 21. Bovendien maakt het systeem met zeven fragmenten een snelle invoeging van mutaties mogelijk die voortkomen uit het sequencen van nieuwe klinische isolaten of het verwisselen van regio’s van verwante coronavirussen die bij dieren worden aangetroffen 13 , 22 . Gezamenlijk biedt het omgekeerde genetische systeem een ​​schat aan mogelijkheden om SARS-CoV-2-infectie en pathogenese te onderzoeken en te bestuderen.

Hoewel de in vitro ligatiebenadering een snelle voorbereiding van mutante en reportervirussen mogelijk maakt, vereist de vereiste om RNA van genoomlengte te assembleren en te transcriberen technische expertise. Alternatieve omgekeerde genetische systemen van het coronavirus hebben gebruik gemaakt van bacteriële kunstmatige chromosomen, een vacciniavirus en een op gistrecombinatie gebaseerde assemblage 11 , 19 . Deze alternatieve systemen bieden minder assemblagevereisten, maar zijn meer vatbaar voor mogelijke off-target mutaties vanwege het gebruik van een grotere omvang van viraal cDNA en de behoefte aan amplificatie in gastheercellen. Naast onze SARS-CoV-2 infectieuze cDNA-kloon 3 is aangetoond dat een op gist gebaseerd platform en een vergelijkbare benadering met meerdere plasmiden recombinant SARS-CoV-2 produceren 19 , 23. Het gistplatform vereiste screening van verschillende klonen om virus te identificeren dat equivalent is aan het oorspronkelijke klinische isolaat 19 . Daarentegen leverden beide op cDNA-fragmenten gebaseerde benaderingen de productie op van recombinant SARS-CoV-2 equivalent aan het klinische isolaat. Deze resultaten komen overeen met de eerder gekarakteriseerde fenotypes van de epidemische SARS-CoV- en MERS-CoV-isolaten in vergelijking met hun recombinante versies 5 , 15 . De trouw aan het klinische isolaat van SARS-CoV-2 is een belangrijk voordeel van deze infectieuze kloonsystemen met meerdere plasmiden.

Beperkingen en overwegingen bij experimenteel ontwerp

Ons experimentele ontwerp is om zeven cDNA-fragmenten te klonen die het hele genoom van SARS-CoV-2 beslaan in plasmidevectoren, wat resulteert in zeven plasmiden. De zeven virale cDNA-fragmenten worden gemanipuleerd tot plasmiden op basis van de nucleotidesequenties voor type IIS-restrictie-enzymen. De restrictie-enzymen van het type IIS werden gekozen omdat ze asymmetrische DNA-sequenties herkennen en buiten hun herkenningssequentie splitsen, waardoor gerichte assemblage van meerdere DNA-fragmenten mogelijk wordt. Er zijn twee overwegingen bij het kiezen van de start- en eindnucleotideposities voor elk cDNA-fragment: (i) om het volledige virale genoom te verdelen in zeven fragmenten met een redelijke DNA-lengte voor snelle amplificatie van polymerasekettingreactie met omgekeerde transcriptie (RT-PCR) en moleculaire klonering op basis van de restrictie-enzymen BsaI en Esp3I en (ii) om de niet-specifieke ligatie te minimaliseren van de vier-base overhangen gegenereerd door BsaI en Esp3I. Deze benadering met zeven plasmiden maakt gelijktijdige manipulatie van verschillende virale fragmenten van belang mogelijk via standaard moleculaire benaderingen (bijv. PCR of plaatsgerichte mutagenese) om recombinante virussen met meerdere veranderingen te genereren.

Ondanks het succes op alle coronavirusplatforms, kunnen verschillende problemen de werkzaamheid van ons omgekeerde genetische systeem mogelijk verstoren. We hebben variabiliteit gevonden in de elektroporatiecapaciteit van Vero E6-cellijnen. Hoewel de elektroporatiebuffer de efficiëntie in Vero E6-cellen verbetert, nemen we ook een alternatieve benadering op met BHK-21-cellen, een fibroblastcellijn van de gouden Syrische hamster die kan worden gebruikt voor het genereren van virussen in andere CoV-systemen 6 , 7. BHK-21-cellen zijn niet geschikt voor voortdurende SARS-CoV-2-replicatie vanwege een gebrek aan expressie van angiotensine-converting enzyme 2 (ACE2)-receptor; deze cellen verdragen elektroporatie echter goed en maken voldoende SARS-CoV-2-productie mogelijk om samengekweekte Vero E6-cellen te zaaien. Over het algemeen is de efficiëntie van elektroporatie laag in zowel BHK-21- als Vero E6-cellen (<1% cellen op basis van de mNeonGreen-expressie van cellen die zijn geëlektroporeerd met mNeonGreen-bevattend SARS-CoV-2 RNA) en co-cultuur met niet-geëlektroporeerde Vero E6-cellen kan verbeteren virale opbrengst voor passage 0. We vinden met name dat de virale opbrengsten verbeteren met de daaropvolgende passage en deze voorraden worden over het algemeen gebruikt voor experimenten.

Een andere belangrijke barrière voor succes met ons omgekeerde genetische systeem zijn deleties en mutaties tijdens het verspreiden van de cDNA-plasmiden. Ondanks hun kleinere omvang en onze inspanningen om toxische elementen te verstoren, zijn de SARS-CoV-2-plasmiden nog steeds vatbaar voor fouten en deleties wanneer ze worden geamplificeerd in Escherichia coli . Om de opname van deze fouten te verminderen, sequensen we om cDNA-plasmiden te verifiëren in elk stadium van amplificatie. Om voortdurende mutaties/deleties in bepaalde SARS-CoV-2-plasmiden te voorkomen, nemen we ook instructies op voor alternatieve groeiomstandigheden met lagere temperaturen (25 of 30 °C) voor langere tijd (tot 48 uur) om het genereren van cDNA te vergemakkelijken met getrouwheid aan de oorspronkelijke virale sequentie.

Daarnaast gebruiken we een Dark Reader-blauwe transilluminator voor manipulatie van SARS-CoV-2-plasmide-DNA. We ontdekten dat het gebruik van standaard ultraviolette (UV) lichtbakken sequentiemutaties en slecht virusherstel oplevert. We merken ook op dat elk plasmide competente cellen heeft voorgeschreven (Top10 of EPI300), die geassocieerd zijn met lagere mutatie- en deletiefrequenties en verbeterde plasmide-opbrengsten. Over het algemeen vereist dit omgekeerde genetische systeem aanzienlijke inspanningen om te voorkomen dat mutaties/deleties de SARS-CoV-2-generatie verstoren.

De voorwaarden voor assemblage, ligatie en elektroporatie van het virale nucleïnezuur moeten zorgvuldig worden overwogen bij het gebruik van dit omgekeerde genetische systeem. Een belangrijke uitdaging is de vereiste voor een voldoende concentratie van cDNA-fragmenten voor ligatie. We hebben berekeningen opgenomen voor de benodigde hoeveelheid van elk fragment, evenals een visueel beeld van de cDNA-fragmenten (na gelzuiveringen) om een ​​referentie te geven voor de hoeveelheid plasmide-DNA die nodig is voor succesvolle in vitro assemblage van cDNA van volledige lengte (Fig. 2a ) . We nemen ook alternatieve groeiomstandigheden (grotere culturen en langere kweektijd) op om indien nodig plasmiden met een lage opbrengst te versterken. Over het algemeen vinden we het nodig om een ​​maxiprep (Qiagen) voor elk plasmide te voltooien om voldoende DNA-concentraties te hebben om cDNA-assemblage van volledige lengte te vergemakkelijken.

Figuur 2
Fig. 2: Gelextractie van SARS-CoV-2-fragmenten, cDNA van volledige lengte en viraal RNA van volledige lengte.

We nemen gelafbeeldingen op van SARS-CoV-2-DNA van volledige lengte na ligatie en RNA van volledige lengte na in vitro transcriptie om de hoeveelheid te tonen die nodig is voor effectieve versus ineffectieve elektroporatie en virusherstel (Fig. 2b-d ). Voor slechte DNA-opbrengsten van volledige lengte bieden we ook alternatieve ligatievoorwaarden. Samen zouden deze tips en gegevens kritische referenties moeten bieden voor het gebruik en de manipulatie van de SARS-CoV-2 infectieuze kloon.

Materialen

Cellen

  • EPI300 competente cellen (Lucigen, cat. nr. C300C105)
  • One Shot TOP10 chemisch competente cellen (Thermo Fisher Scientific, cat. nr. C404010)
  • BHK-21 cellen (RRID: CVCL_1915 ; cat. nr. ATCC CCL-10)
  • Vero E6-cellen (lab-gepasseerd derivaat van ATCC CRL-1586; RRID: CVCL_0574 )VOORZICHTIGHEIDControleer regelmatig of de gebruikte zoogdiercellen authentiek zijn en niet besmet zijn met mycoplasma.

Reagentia

  • 0,25% trypsine-ethyleendiaminetetra-azijnzuur (EDTA) (1×) (Thermo Fisher Scientific, cat. nr. 25200-072)
  • 0,4% (wt/vol) Trypan blauw (Thermo Fisher Scientific, cat. no.15250-061)
  • 1 kb DNA ladder (NEB, cat.nr. N3232L)
  • 10× Cutsmart buffer (NEB, cat.nr. B7204S)
  • Absolute ethanol (EtOH; watervrij, 200 proof/100% (vol/vol); VWR, cat. no. 89125-170)
  • Zure fenol:chloroform (pH 4,5; Ambion, cat.nr. AM9722)
  • Agarose (Bio-Rad, cat.nr.1613102)
  • Ampicilline-natriumzout (Sigma-Aldrich, cat.nr. A9518)
  • Chlooramfenicol (Sigma-Aldrich, cat.nr. 0378)
  • CopyControl inductieoplossing (Lucigen, cat.nr. CCIS125)
  • Dulbecco’s gemodificeerd Eagle’s medium (DMEM), hoge glucose (Life Technologies, cat. no. 11965-092)
  • DNA-laadbuffer (NEB, cat.nr. B7024S)
  • EDTA (Sigma-Aldrich, cat.nr. 324503)
  • Elektroporatiebuffer (Mirus, cat.nr. MIR 50117)
  • Ethidiumbromide (EB; 10 mg ml −1 ; Bio-Rad, cat. nr. 161-0433)
  • Foetaal runderserum (FBS) (Hyclone, cat. nr. SH3007103HI)
  • Glycerol (≥99,5% (wt/vol); Sigma-Aldrich, cat. nr. G9012)
  • Waterstofchloride (HCl; 36,5-38%; Sigma-Aldrich, cat. nr. H1758-500ML)
  • illustra MicroSpin G-25 kolommen (GE Healthcare, cat.nr. 27-5325-01)
  • Isopropanol (Sigma-Aldrich, cat.nr. I9516)
  • Luria-Bertani (LB) agar (kant-en-klaar poeder; Thermo Fisher Scientific, cat.nr. DF0401-17)
  • LB-bouillon (kant-en-klaar poeder; Thermo Fisher Scientific, cat.nr. DF0402-08-0)
  • mMESSAGE mMACHINE T7 transcriptiekit (Thermo Fisher Scientific, cat.nr. AM1344)
  • Fosfaatgebufferde zoutoplossing (PBS) (Thermo Fisher Scientific, cat. nr. 10010023)
  • Penicilline/streptomycine (Thermo Fisher Scientific, cat. no.15140-122)
  • Fenol:chloroform:isoamylalcohol 25:24:1 (pH 8,05; Invitrogen, cat.nr. 15593-031)
  • Platinum SuperFi II DNA-polymerase (Thermo Fisher Scientific, cat.nr. 1236010)
  • QIAGEN plasmide maxi-kit (Qiagen, cat.nr. 12163)
  • QIAprep spin Miniprep-kit (Qiagen, cat.nr. 27106)
  • QIAquick gelextractiekit (Qiagen, cat.nr. 28706)
  • QIAquick PCR-zuiveringskit (Qiagen, cat.nr. 28106)
  • Restrictie-enzym BsaI-HFv2 (NEB, cat.nr. R3733)
  • Restrictie-enzym Esp3I (NEB, cat.nr. R0734L)
  • Restrictie-enzym PvuI-HF (NEB, cat.nr. R3150S)
  • Restrictie-enzym SnaBI (NEB, cat.nr. R0130L)
  • Ribonucleotide-oplossingsmix (rNTP-oplossingsmix; NEB, cat.nr. N0466L)
  • SOC uitgroeimedium (10 ml; Invitrogen, cat.nr. 15544034)
  • Natriumacetaat (Sigma-Aldrich, cat.nr. S8750)
  • Natriumhydroxidepellets (NaOH; Sigma-Aldrich, cat.nr. S8045)
  • SuperScript eerste-strengs synthesesysteem (Thermo Fisher Scientific, cat. no. 18091050)
  • T4-ligase en ligatiebuffer (NEB, cat.nr. M0202L)
  • Tris-base (Sigma-Aldrich, cat.nr. T1503)
  • TRIzol LS-reagens (Thermo Fisher Scientific, cat.nr. 10296028)
  • UltraPure DNase/RNase-vrij gedestilleerd water (Thermo Fisher Scientific, cat. nr. 10977015)

Apparatuur

  • 1L glazen fles (Duran, cat.nr. 21820545)
  • 2 ml buis met schroefdop (VWR, cat.nr. 101093-752)
  • 250 ml glazen fles (Duran, cat.nr. 21801365)
  • Kuvetten 4 mm (Bio-Rad, cat.nr. 1652088)
  • 90 mm petrischalen (Thermo Fisher Scientific, cat. nr. 263991)
  • Geautomatiseerde celteller (Bio-Rad, cat.nr. 1450102)
  • C-vouw papieren handdoek (Scott)
  • CO 2 -incubator (NewAire)
  • Koeler (Coleman)
  • Telschuif (Bio-Rad, cat.nr. 145-0011)
  • Dark Reader-transilluminators (DR89X-model, Clare Chemical Research)
  • Eppendorf tafelcentrifuge (modellen 5810R, 5424R, 5425)
  • Erlenmeyer, 1 L (Pyrex, cat.nr. 4446-1L)
  • Erlenmeyer, 250 ml (Pyrex, cat.nr. 4446-250)
  • Falcon 15 ml conische tube (Corning, cat.nr. 352096)
  • Falcon 50 ml conische tube (Corning, cat.nr. 352070)
  • Fisherbrand Isotemp-roerder (Thermo Fisher Scientific)
  • Gel DOC EZ systeem (Bio-Rad, cat.nr. 170827)
  • Gene Pulser Xcell elektroporatiesystemen (Bio-Rad, cat.nr. 1652660)
  • Horizontale elektroforesesystemen (Bio-Rad)
  • Incubator voor bacteriecultuur (Thermo Fisher Scientific)
  • L-vormige celspreiding (Thermo Fisher Scientific, cat. nr. 14-665-230)
  • Microcentrifugebuisje, 1,7 ml (Axygen, cat.nr. MCT-175-C)
  • Magnetron (Oster)
  • Milli-Q ultrapuur watersystemen
  • New Brunswick Scientific Innova 43R incubator shakers (Eppendorf, cat. no. M1320-0000)
  • PCR-buisje, 0,2 ml (Axygen, cat.nr. PCR-02-C)
  • pH-meter (Sartorius)
  • Research Plus-pipetten (0,1-2,5, 0,5-10, 2-20, 1-100, 20-200 en 100-1.000 µL; Eppendorf)
  • Secura weegschaal (Sartorius, cat.nr. ENTRIS 6202-1S)
  • S1 pipetvullers (Thermo Fisher Scientific, cat.nr. 9501)
  • Spectrofotometer (DS-11-serie, DENOVIX)
  • T175 kolf (Corning, cat. nr. 431080)
  • T-75 kolf (Corning, cat. no. 430641U)
  • Thermocycler (modellen C1000 Touch en T100, Bio-Rad)
  • VACUBOY (INTEGRA Biowetenschappen)
  • Vortex (Thermo Fisher Scientific)
  • Waterbad (Thermo Fisher Scientific)

Reagens instellen

0,8% agarosegel

Weeg 0,8 g agarosepoeder af in een erlenmeyer van 250 mL en voeg 100 mL 1× Tris-acetaat-EDTA (TAE) buffer toe. Wervel de erlenmeyer om de inhoud te mengen en bedek de bovenkant van de erlenmeyer met plasticfolie om verdamping te verminderen. Magnetron gedurende 1-2 min om de agarose volledig te smelten, maar niet overkoken. Koel de agarose-oplossing af tot 50-60 °C en giet deze langzaam in een geldok om bellenvorming te voorkomen. Voeg EB toe aan de agarose-oplossing tot een eindconcentratie van 0,5 μg ml −1 , verdeel de EB gelijkmatig door het geldock zachtjes te schudden en steek snel een gelkam in het geldock. De agarosegel is klaar voor gebruik zodra deze stolt.

Ampicilline-voorraad (100 mg ml −1 )

Weeg 10 g ampicilline-natriumzout af in een schone glazen fles van 250 ml. Voeg 100 ml UltraPure gedeïoniseerd water toe en roer grondig totdat de componenten volledig zijn opgelost. Steriliseer de ampicilline-oplossing door een 0,22-μm filter te passeren en aliquot in steriele 1,7 ml buizen (1 ml per buis) om meerdere bevriezing-dooien te voorkomen. Ampicilline-aliquots kunnen gedurende ten minste 1 jaar bij –20 °C worden bewaard. Bewaar de ampicillinevoorraad bij frequent gebruik niet langer dan 1 maand bij 4 °C.

Celkweekmedia

Bereid al het celkweekmedium voor in een bioveiligheidskast. Om 10% of 2% FBS-medium te maken, voegt u 55 of 10 mL FBS toe aan 500 mL hoog-glucose DMEM aangevuld met respectievelijk 1% penicilline/streptomycine-oplossing. Gebruik 10% FBS-kweekmedium voor celvermeerdering en 2% FBS-kweekmedium voor virusinfectie en -vermeerdering.

Chlooramfenicolvoorraad (25 mg ml −1 )

Voeg 2,5 g chlooramfenicol toe aan 100 ml absolute ethanol en roer krachtig om ervoor te zorgen dat al het chlooramfenicolpoeder volledig is opgelost. Filtersterilisatie is niet nodig omdat het in 100% ethanol zit. Verdeel de chlooramfenicol-voorraadoplossing in porties (500 L in een buis van 1,7 ml). Chlooramfenicol-aliquots kunnen gedurende ten minste 1 jaar in een vriezer bij -20 °C worden bewaard.

VOORZICHTIGHEID

Ethanol is ontvlambaar. Houd ethanol en opgeloste chlooramfenicolvoorraden uit de buurt van vuur.

EDTA, 0,5 M, pH 8,0

Voeg 148 g EDTA toe aan 1 L UltraPure gedeïoniseerd water en meng grondig op een magnetische roerder. Om de oplosbaarheid van EDTA in water te verbeteren, stelt u de pH in op 8,0 door geleidelijk NaOH (~30-40 g) aan de oplossing toe te voegen. Blijf roeren totdat alle componenten volledig zijn opgelost en steriliseer de EDTA-oplossing door 30 minuten te autoclaveren bij 121 °C. De EDTA-oplossing is tot 1 jaar stabiel bij kamertemperatuur (20–30 °C).

70% ethanol

Meng 15 ml nucleasevrij water met 35 ml absolute ethanol in een Falcon-buis van 50 ml en bewaar bij -20 °C voor langdurige opslag.

VOORZICHTIGHEID

70% ethanol is nog steeds ontvlambaar. Houd voorraden uit de buurt van vuur.

50% glycerolbuffer

Combineer 50 ml glycerol met 50 ml UltraPure gedeïoniseerd water in een glazen fles van 250 ml en schud de oplossing door elkaar. Autoclaaf de oplossing bij 121 ° C gedurende 20 minuten en plaats in een vriezer van 4 ° C voor opslag.

VOORZICHTIGHEID

Bewaar en bewaar de 50% glycerolbuffer in een steriele omgeving.

LB-agarplaten met ampicilline of chlooramfenicol

Voeg 28 g LB-agarpoeder toe aan 800 ml UltraPure gedeïoniseerd water in een glazen fles van 1 liter en roer om te mengen. Autoclaaf te steriliseren bij 121,0 ° C gedurende 30 min, en de componenten worden opgelost na autoclaveren. Koel de LB-agaroplossing af tot 55 °C voordat ampicilline (tot eindconcentratie van 100 g ml 1 ) of chlooramfenicol (tot eindconcentratie van 12,5 g ml 1 ) wordt toegevoegd. Giet in een steriele bankruimte LB-agaroplossing (~ 20 mL per schaaltje) in een petrischaaltje van 90 mm. Gewoonlijk is 800 ml LB-agaroplossing voldoende voor het gieten van 20-30 agarplaten. Plaats de deksels terug op de platen en koel de platen af ​​bij kamertemperatuur totdat de agar stolt. Agarplaten die antibiotica bevatten, kunnen tot 3 maanden worden bewaard in plastic zakken of worden afgesloten met Parafilm bij 4 ° C in het donker.

VOORZICHTIGHEID

Houd de chlooramfenicolvoorraden uit de buurt van vuur.

LB middelgrote oplossing

Los 20 g LB-poeder op in 1 L UltraPure gedeïoniseerd water en autoclaaf bij 121 °C gedurende 30 minuten voor sterilisatie. Na autoclaveren kan de LB-mediumoplossing maximaal 4 maanden bij kamertemperatuur worden bewaard.

Om het LB-medium met ampicilline of chlooramfenicol voor de selectie van bacteriën voor te bereiden, voegt u 0,8 ml ampicillinevoorraad (80 mg ml −1 ) of 500 μL chlooramfenicolvoorraad (25 mg ml −1 ) toe aan respectievelijk 1 L LB-medium in een gesteriliseerde omgeving. De uiteindelijke werkconcentraties zijn 100 g ml -1 voor ampicilline en 12,5 μg ml -1 voor chlooramfenicol. Bewaar het LB-medium met antibiotica bij 4 ° C in het donker.

VOORZICHTIGHEID

Antibiotica worden in de loop van de tijd afgebroken, dus LB-medium dat antibiotica bevat, moet vers of regelmatig worden gemaakt.

Natriumacetaat (3,0 M, pH 5,2)

Los 246,1 g natriumacetaat op in 500 ml gedeïoniseerd water. Stel de pH in op 5,2 met behulp van ijsazijn. Laat de oplossing een nacht afkoelen. Stel de pH nogmaals in op 5,2 met ijsazijn. Pas het uiteindelijke volume aan tot 1 L met gedeïoniseerd water en filter-steriliseren.

50× TAE-buffer

Weeg 484 mg Tris-base af in een schone glazen fles van 2 liter en voeg ~ 1500 ml UltraPure gedeïoniseerd water toe. Nadat de Tris-base is opgelost, giet je voorzichtig 114,2 ml ijsazijn en 200 ml 0,5 M EDTA (pH 8,0) in de oplossing en meng je ze door te roeren. Vul de TAE-oplossing aan tot het eindvolume van 2 L met water en bewaar de 50× TAE-buffer bij kamertemperatuur.

Om 1 × TAE-buffer (40 mM Tris, 20 mM acetaat en 1 mM EDTA), die wordt gebruikt voor DNA-elektroforese, te bereiden, verdun 400 ml 50 × TAE-buffer in 19,6 L UltraPure gedeïoniseerd water.

Plasmiden

We hebben met succes zeven verschillende DNA-fragmenten gekloneerd die het hele genoom van SARS-CoV-2 omspannen in commerciële pUC57 (GenScript, Piscataway, NJ) of pCC1 (Epicenter Biotechnologies, Madison, WI) vectoren, resulterend in zeven plasmiden: pUC57-CoV-2 -F1, pCC1-CoV-2-F2, pCC1-CoV-2-F3, pUC57-CoV-2-F4, pUC57-CoV-2-F5, pUC57-CoV-2-F6 en pCC1-CoV-2-F7 . De sequenties van de zeven plasmiden zijn opgenomen in aanvullende figuur 1 .. Type IIS-restrictie-enzymen BsaI en Esp3I, die asymmetrische DNA-sequenties herkennen en buiten hun herkenningssequentie splitsen, zijn op grote schaal gebruikt voor Golden Gate-assemblage om gelijktijdige gerichte assemblage van meerdere DNA-fragmenten te garanderen. Aanvullende restrictie-enzymen (zoals PvuI en SnaBI) worden gebruikt om de gewenste DNA-fragmenten efficiënt op te lossen van andere bijproducten in dezelfde restrictiereacties tijdens elektroforese. Tabel 1 schetst de restrictie-enzymsplitsingsplaatsen in de zeven plasmiden die zouden worden gebruikt voor het voorbereiden van de fragmenten voorafgaand aan ligatie in dit protocol. De zeven plasmiden kunnen worden gebruikt als sjablonen voor het genereren van interessante mutaties via standaard moleculaire benaderingen, zoals PCR of plaatsgerichte mutagenese.Tabel 1 Restrictie-enzymen voor validatie van zeven SARS-CoV-2-plasmiden

Tafel op ware grootte

pUC57

pUC57 is een plasmide met een hoog aantal kopieën (500-700 kopieën per cel) dat een ampicilline-resistent gen bevat. Het kan worden vermeerderd in E. coli om een ​​hoge opbrengst aan plasmiden te produceren voor stroomafwaarts gebruik. pUC57-CoV-2-F1, pUC57-CoV-2-F4, pUC57-CoV-2-F5 en pUC57-CoV-2-F6 zijn stabiel wanneer ze worden vermeerderd in de commercieel verkrijgbare Top10 competente cellen. Verschillende pogingen om de F2-, F3- en F7-fragmenten te klonen in de pUC57-vector die zich in de Top10-competente cellen kan voortplanten, mislukten, waarschijnlijk vanwege de toxiciteit van deze fragmenten voor de bacteriële cellen. Ten slotte werden F2, F3 en F7 met succes gekloneerd in pCC1-vector en stabiel gepropageerd in EPI300-competente cellen.

KRITIEK

Top10 competente cellen worden aanbevolen. Andere cellen moeten worden geverifieerd op compatibiliteit/stabiliteit van plasmiden voordat grote partijen van die plasmiden worden bereid.

pCC1

pCC1 is een bacmide-kloneringsvector met een gecontroleerd aantal kopieën. Het is ideaal voor het amplificeren van grote, onstabiele en bacterietoxische DNA-fragmenten in E. coli . Vóór inductie is het aantal kopieën van pCC1-plasmide één kopie per cel. Na inductie door L -arabinose kan het aantal kopieën van pCC1 10-20 kopieën per cel in de bacteriecellen zijn (EPI300 competente cellen worden aanbevolen voor het vermeerderen van de van pCC1 afgeleide plasmiden).

Apparatuur instellen

Opstelling elektroporator

Dit protocol is gebaseerd op het gebruik van Gene Pulser Xcell-elektroporatiesystemen met behulp van de exponentiële vervalpuls voor het elektroporeren van RNA’s in zoogdiercellen. We hebben de parameterinstellingen geoptimaliseerd, inclusief spanningen, capaciteit en pulstijden voor verschillende cellen. De omstandigheden die in deze studie worden gebruikt, geven ons een hoge en reproduceerbare transformatie-efficiëntie met een hoge levensvatbaarheid van cellen na elektroporatie. De parameterinstellingen voor elektroporatie van Vero-cellen worden hieronder aangegeven: spanning, 270 V; capaciteit, 950 µF; weerstand, ; cuvetgrootte (mm): 4. Er is één puls nodig voor elektroporatie van Vero-cellen. De parameterinstellingen voor elektroporatie van BHK-21-cellen zijn: spanning, 850 V; capaciteit, 25 µF; weerstand, ; cuvetgrootte (mm): 4. Er zijn drie pulsen met intervallen van 3 s tussen elke puls nodig voor elektroporatie van BHK-21-cellen.

Procedure

Fase 1: Vermeerdering van plasmiden die SARS-CoV-2-fragmenten bevatten

Tijdstip 3,5 d

Chemische transformatie

Tijdsduur 2 uur

KRITIEKE STAP

De transformatie moet worden uitgevoerd in een steriele omgeving om besmetting te voorkomen.

  1. 1Voer vóór de transformatie de volgende stappen uit:
    • Kwantificeer de concentratie van elk plasmide met behulp van een spectrofotometer
    • Verwarm een ​​waterbad tot 42 °C
    • Desinfecteer het tafeloppervlak met 70% ethanol
    • Steek een bunsenbrander aan voor een steriele omgeving voor transformatieKRITIEKE STAPHet waterbad moet regelmatig worden gekalibreerd voor een nauwkeurige temperatuur. Een verkeerde temperatuur zou de efficiëntie van de transformatie verminderen.
  2. 2Ontdooi geschikte chemisch competente cellen op ijs. Voeg 1–10 ng plasmiden toe aan de ontdooide cellen en meng door op de buis te tikken of zachtjes te zwenken.
    • Gebruik voor van pUC57 afgeleide plasmiden, waaronder pUC57-CoV-2-F1, pUC57-CoV-2-F4, pUC57-CoV-2-F5 en pUC57-CoV-2-F6, Top10 competente cellen voor transformatie.
    • Gebruik voor pCC1-afgeleide plasmiden, waaronder pCC1-CoV-2-F2, pCC1-CoV-2-F3 en pCC1-CoV-2-F7, EPI300 competente cellen voor transformatie.KRITIEKE STAPBevoegde cellen zijn gevoelig voor temperatuur en zout/bufferomstandigheden. Voeg de DNA-oplossing toe met een volume <10% van de bevoegde celsuspensie. Houd de bevoegde cellen op ijs voorafgaand aan hitteschok. De ontdooide competente cellen mogen niet opnieuw worden ingevroren bij -80 °C.
  3. 3Na het toevoegen van de plasmiden, dompel de buis onmiddellijk onder in ijs. Incubeer de plasmide-cel mengsels gedurende 20-30 min op ijs.
  4. 4Incubeer de buis met de plasmide-cel mengsels in een waterbad van 42 ° C gedurende 30 s.
  5. 5Zet de buis onmiddellijk terug op ijs en incubeer gedurende 2 minuten.
  6. 6Voeg 250 L SOC medium (voorverwarmd bij kamertemperatuur) toe aan de buis met getransformeerde cellen.
  7. 7Schud de culturen in een incubator van 37 °C bij 230 rpm gedurende 60 minuten om de cellen te herstellen.
  8. 8Tijdens de incubatieperiode, warme LB-agarplaten aangevuld met 100 g mL −1 ampicilline (voor pUC57-afgeleide plasmiden) of 12,5 μg mL -1 chlooramfenicol (voor pCC1-afgeleide plasmiden) in een incubator van 37 °C.
  9. 9Na de incubatie van 60 minuten, ent u 50 μL van de culturen op een voorverwarmde LB-agarplaat die is geleverd met de juiste antibiotica en verspreidt u de culturen over de plaat met behulp van L-vormige celspreiders.
  10. 10Plaats de platen rechtop in een incubator van 37 °C gedurende 30 minuten zodat de culturen volledig kunnen worden geabsorbeerd. Keer daarna de platen om en incubeer een nacht bij 37 °C (16-20 uur).PROBLEEMOPLOSSEN

Koloniescherm

Timing 1 d of ‘s nachts

  • 11 Pak na een nacht incubatie verschillende goed gescheiden kolonies op met steriele P10-tips en ent de kolonies in LB-bouillon die de juiste antibiotica bevat.
    • Voor pUC57 vector-afgeleide plasmiden, inoculeer de kolonies in een conische buis van 50 mL met 10 mL LB Bouillon met 80 g mL −1 ampicilline.
    • Voor pCC1 vector-afgeleide plasmiden, inoculeer de kolonies in een conische buis van 50 mL met 10 mL LB Bouillon met 12,5 μg mL −1 chlooramfenicol.KRITIEKE STAPDe kolonies kunnen in grootte variëren als gevolg van mogelijke cryptische vreemde genexpressie van het virale genoom, dat gewoonlijk toxisch is voor de E. coli . Pick-up vier tot zes kleine/middelgrote kolonies per plasmide voor validatie.PAUZEPUNTBewaar de LB-agarplaten bij 4 °C in het donker voor toekomstig gebruik (tot 1 maand).
  • 12 Incubeer de bacterieculturen bij 37 °C onder schudden bij 230 rpm gedurende de nacht (12-16 uur).KRITIEKE STAPKweek de bacterieculturen in buizen met een volume van meer dan drie keer dat van het kweekvolume. De buizen mogen niet volledig worden afgedicht om voldoende luchtuitwisseling te garanderen. Verleng de incubatietijd niet omdat er na verloop van tijd meer ‘toxine’ ophoopt.
  • 13 Bewaar de volgende dag, voorafgaand aan Miniprep, een bacterie-glycerolvoorraad voor elke kolonie door 0,5 ml nachtkweek te mengen met 0,5 ml 50% glycerol in een steriele Eppendorf-buis van 1,7 ml. Bewaar de glycerolvoorraad in de vriezer van −80 °C voor toekomstig gebruik (voorraad moet jarenlang stabiel zijn). Voor pUC57-afgeleide plasmiden zijn de resterende nachtculturen nu klaar voor Miniprep, dus u kunt stap 14 overslaan en doorgaan naar stap 15. Voor pCC1-afgeleide plasmiden is een extra inductiestap (stap 14) nodig.
  • 14 (Optioneel) Alleen voor pCC1-afgeleide plasmiden, inoculeer 1,5 ml nachtelijke culturen in een nieuwe conische buis van 50 ml met 13,5 ml LB-bouillon aangevuld met 12,5 g ml −1 chlooramfenicol en 15 μL inductieoplossing (aangevuld door de fabrikant).
  • 15 Schud de cultuur gedurende 5 uur bij 37 °C en 230 rpm en gebruik vervolgens de geïnduceerde culturen voor Miniprep.KRITIEKE STAPDe inductietijd mag niet langer zijn dan 5 uur. Een langere kweektijd kan het risico op mutatie/deletie in de DNA-fragmenten van de SARS-CoV-2 verhogen.

Plasmide Miniprep

Tijdstip 1–2 uur

  • 16 Oogst de bacteriecultuur door centrifugeren bij 3.900 rpm gedurende 10 minuten bij 16 ° C in een benchtop centrifuge (Eppendorf-model 5810R).
  • 17 Doseer het medium in een afvalcontainer met 20% bleekmiddel. Keer de buisjes om en leg ze op absorberend papier om de resterende vloeistof te verwijderen.
  • 18 Bewaar de bacteriële pellets om plasmiden te extraheren met behulp van een Qiagen Miniprep-kit door de instructies van de fabrikant te volgen.PAUZEPUNTDe korrels kunnen ofwel direct voor Miniprep worden gebruikt of tot gebruik bij -20 °C worden bewaard.
  • 19 Voeg bij de laatste stap van Miniprep 50 μL nucleasevrij water (voorverwarmd op 56°C) toe aan de Miniprep-kolommen. Centrifugeer bij> 12.000 g gedurende 2 minuten bij kamertemperatuur om de plasmiden te elueren.
  • 20 Meet de opbrengst en kwaliteit van de plasmiden met behulp van een spectrofotometer.PAUZEPUNTDe geëlueerde plasmiden kunnen ofwel onmiddellijk worden gebruikt of tot ten minste 1 jaar bij -20 °C worden bewaard.

Plasmidevalidatie door restrictie-enzymdigestie

Tijdsduur 2 uur

KRITIEK

De hierboven bereide plasmiden worden gedigereerd met geschikte restrictie-enzymen. De restrictie-enzymen die zijn gebruikt om de zeven SARS-CoV-2-plasmiden te valideren en de verwachte DNA-fragmenten na restrictie zijn aangegeven in Tabel 1 .

  • 21 Stel een verteringsreactiesysteem van 10 μL in voor elk plasmide in een PCR-buis van 0,2 mL. De opstellingen zijn aangegeven in de onderstaande tabel.Reactiesystemen voor plasmidevalidatieonderdeelVolume (μL)Nucleasevrij waterTot 1010× Cutsmart-buffer1Restrictie-enzymen0,5–1 aDNA-plasmideNader te bepalen (200-300 ng)
    1. a Het totale volume van het enzym moet <10% van het totale reactievolume zijn
  • 22 Incubeer de reactie bij 37 ° C gedurende 1 uur. Giet tijdens de incubatieperiode een 0,6% agarosegel met EB met een 1 mm brede put voor DNA-elektroforese.VOORZICHTIGHEIDEB is een mutageen. Draag de juiste persoonlijke beschermingsmiddelen (PBM) bij het hanteren van EB-bevattende oplossingen en gels.
  • 23 Na 1 uur incubatie worden reacties gestopt door 2 L 6 × DNA-laadbuffer toe te voegen. Laad de monsters op een 0,8% agarosegel met behulp van een P10-pipet. Pipetteer 5 μL 1-kb DNA ladder in een onafhankelijk putje van dezelfde gel.
  • 24 Los de DNA-fragmenten op door elektroforese bij 120 V gedurende 25 minuten in 1 × TAE-buffer.
  • 25 Verwerven van beelden van de gel met behulp van een Gel DOC-EZ imager. Evalueer de resultaten voor elk plasmide, verwijzend naar tabel 1 voor verwachte fragmentgroottes. Figuur 3 toont een voorbeeld van de resultaten van de rectiedigestie. Voor elk plasmide is één gevalideerde kolonie voldoende om door te gaan naar de volgende stap.Fig. 3: Representatieve gelafbeeldingen post-restrictie-enzymdigestie.figuur 3De DNA-ladders (bp) zijn aangegeven. De overeenkomstige fragmenten van SARS-CoV-2 die uit de plasmiden zijn beperkt, worden geschetst.Afbeelding op volledige groottePROBLEEMOPLOSSEN

Plasmide Maxiprep

Tijdstip 24 uur

KRITIEK

De glycerolvoorraden van gevalideerde plasmiden worden gebruikt voor de bereiding van grote partijen plasmiden.

  • 26 Inoculeer 0,1 ml glycerolvoorraad in een erlenmeyerkolf van 250 ml met 50 ml LB-medium aangevuld met geschikte selectieve antibiotica.
  • 27 Schud de culturen in een incubator van 37 °C bij 230 rpm gedurende de nacht (12-16 uur). Voor pUC57-afgeleide plasmiden zijn de nachtculturen klaar voor Maxiprep (50 ml zou voldoende moeten zijn), dus u kunt stap 27 overslaan en doorgaan Stap 28.
  • 28 (Optioneel) Breng alleen voor pCC1-afgeleide plasmiden 50 ml van de nachtculturen over in een erlenmeyer van 2 l die 450 ml verse LB-bouillon bevat, aangevuld met 12,5 g ml −1 chlooramfenicol en 500 μl inductieoplossing. Incubeer de cultuur bij 37 ° C onder schudden bij 230 rpm gedurende 5 uur. De nieuwe culturen worden gebruikt voor Maxiprep.KRITIEKE STAPDe inductietijd mag niet langer zijn dan 5 uur. Een langere kweektijd kan het risico op mutatie/deletie in de DNA-fragmenten van de SARS-CoV-2 verhogen.
  • 29 Pellet de culturen door gedurende 5 minuten bij 7.000 rpm te draaien.
  • 30 Bewaar de pellets voor plasmide-extractie met behulp van de QIAGEN-plasmide plus MAXI-kit volgens de instructies van de fabrikant.PAUZEPUNTDe korrels kunnen ofwel direct worden gebruikt of tot gebruik enkele weken bij -20 °C worden bewaard.
  • 31 Voeg bij de laatste stap van Maxiprep 100-200 L nucleasevrij water (voorverwarmd op 56°C) toe aan de kolommen.
  • 32 Incubeer bij kamertemperatuur of 56 ° C incubator gedurende 2 minuten.
  • 33 Elueer de plasmiden door centrifugeren bij > 12.000 rpm gedurende 2 minuten bij kamertemperatuur.
  • 34 Bepaal de opbrengst en kwaliteit van plasmiden met behulp van een spectrofotometer. Merk op dat de opbrengsten van plasmiden kunnen variëren van 100 tot 300 g.PAUZEPUNTDe geëlueerde plasmiden kunnen ofwel onmiddellijk worden gebruikt of tot gebruik bij -20 ° C worden bewaard.PROBLEEMOPLOSSEN

Fase 2: Bereid DNA-fragmenten voor door restrictie-enzymdigestie en -zuivering

Tijdstip 1 dag

Plasmide verteren

Tijdsduur 4 uur

KRITIEK

Gebruik 30 g plasmiden voor het verteren van restrictie-enzymen. Het hieronder beschreven protocol zal voldoende hoogwaardige DNA-fragmenten herstellen voor meer dan twee in vitro ligatiereacties.

  • 35 Stel een 50-μL verteringsreactiesysteem in met geschikte restrictie-enzymen voor elk plasmide volgens de onderstaande tabel. Schaal het totale verteringsvolume indien nodig op. Tabel 1 toont de enzymen die voor elk plasmide zijn gebruikt.Restrictie-enzymdigestiereacties voor het bereiden van grote hoeveelheden DNA-fragmentenonderdeelVolumeNucleasevrij waterTot 50 L10× Cutsmart-buffer5 LRestrictie-enzymen1 eenheid per g aPlasmidenNader te bepalen (30 g)
    1. a Het totale volume moet <10% van het reactievolume zijn
  • 36 Incubeer de reactiemengsels in een incubator van 37 ° C gedurende 3-4 uur.KRITIEKE STAPDe incubatietijd mag niet langer zijn dan 4 uur om steractiviteiten van het restrictie-enzym te voorkomen.
  • 37 Bereid tijdens de incubatieperiode een 5 cm lange 0,8% agarosegel met een 3 mm brede put. De reactie van elk plasmide zal twee of drie putjes van de agarosegel in beslag nemen. Bereid zeven gels voor alle zeven reacties.KRITIEKE STAPMaak het geldock en de kammen altijd grondig schoon voordat u nieuwe agarosegels giet. Reinig vóór gelelektroforese altijd de elektroforesekamer en gebruik verse gel-loopbuffer om besmetting door andere experimenten te voorkomen.

Extractie van DNA-fragmenten uit gel

Tijdsduur 2 uur

  • 38 Stop na vertering de reactie door 40 L 6× DNA-laadbuffer toe te voegen aan elk reactiebuisje. Meng grondig.
  • 39 Laad ~ 34 μL DNA-monsters in elk putje van de gel met behulp van een P100-pipet. Gebruik één gel voor het laden van één reactie van de DNA-monsters. Laad 5 μL 1-kb DNA-ladder in een apart putje.KRITIEKE STAPLaad het monster langzaam om te voorkomen dat monsters uit de putjes stromen.
  • 40 Los de DNA-fragmenten op door elektroforese bij 120 V gedurende 30 – 40 minuten.
  • 41 Visualiseer de DNA-fragmenten met behulp van een Dark Reader transilluminator.KRITIEKE STAPGebruik geen UV-licht voor het visualiseren van het DNA, omdat dit DNA-schade veroorzaakt, zoals breuken in de suiker-fosfaatruggengraat, pyrimidine-dimerisatie en interstrand-crosslinks, wat zal resulteren in het mislukken van de stroomafwaartse RNA-transcriptie. Bovendien kan UV-straling ongewenste mutaties introduceren in de uiteindelijk teruggewonnen virussen.KRITIEKE STAPMaak de Dark Reader altijd schoon voordat u de gel op het apparaat plaatst om besmetting door andere experimenten te voorkomen.VOORZICHTIGHEIDMinimaliseer uw eigen blootstelling aan de lichten van de Dark Reader.
  • 42 Accijns de doelbanden (verwijzend naar tabel 1 en figuur 3 voor richtlijnen over verwachte fragmentgrootte en verwachte resultaten) met behulp van een schoon mes. Plaats de gelschijfjes met de beoogde DNA-fragmenten in een Falcon-buis van 15 mL.
  • 43 Extraheer DNA-fragmenten uit het gelplakje met behulp van een QIAquick gelextractiekit volgens de instructies van de fabrikant. Gebruik één kolom voor elk DNA-fragment.
  • 44 Voeg aan het einde van de gelextractieprocedures 20 L nucleasevrij water (voorverwarmd op 56°C) toe aan de kolom.
  • 45 Elueer het DNA door te centrifugeren bij 14.000 rpm gedurende 2 minuten bij kamertemperatuur.
  • 46 Meet de concentratie van DNA-fragmenten met behulp van een spectrofotometer. Gewoonlijk is de concentratie van DNA-fragmenten 50-200 ng L −1 .PAUZEPUNTDe DNA-fragmenten kunnen direct worden gebruikt of tot gebruik worden bewaard bij 4 °C. Het gezuiverde DNA-fragment kan maximaal 1 maand bij 4 ° C worden bewaard of bij -20 ° C worden bewaard voor opslag op langere termijn.PROBLEEMOPLOSSEN

Fase 3: In vitro ligatie

Tijdsduur 2,5 d

In vitro ligatiereacties opzetten

Tijdstip 2 dagen

  • 47 Bereken vóór het instellen van de reactie het volume aan DNA-fragmenten dat nodig is voor het samenstellen van de kloon van volledige lengte. Gelijke molaire concentraties van elk fragment moeten worden gebruikt voor de ligatie in dit protocol. De onderstaande tabel laat zien hoe u het volume DNA-fragmenten kunt berekenen voor het samenstellen van 5 μg SARS-CoV-2-DNA van volledige lengte.Berekening van het volume van elk DNA-fragment dat nodig is voor ligatieFragmentGrootte (kb)Massa van elk fragment voor het samenstellen van 1 μg DNA van volledige lengteMassa van elk fragment voor het samenstellen van 5 μg DNA van volledige lengte (μg)F13,6440,121790,61F23.8860,129880,65F34.4800,149730,75F45,6070,187390,935F54.4570,148960,745F64.2840.143180,715F73,5650.119150,595Totaal29.92115
  • 48 Bereid de eerste stap ligatie reacties voor. Stel twee scheidingsligaties (A en B) in volgens de onderstaande tabel. Ligate F1, F2, F3 en F4 in een 0,2 ml PCR-buis om F1–4 DNA te produceren, en ligate F5, F6 en F7 in een aparte PCR-buis om F5–7 DNA te produceren. Stel een ligatiereactie van 40 L in voor individuele ligatiereacties, zoals hieronder.Reactiesysteem voor de eerste stap ligatieonderdeelVolumeNucleasevrij waterOpwaarderen tot 40 μL10× T4-ligatiebuffer4 LT4 DNA-ligase4 LDNA-fragmenten aNader te bepalen
    1. a F1, F2, F3 en F4 worden gebruikt voor ligatie A. F5-, F6- en F7-fragmenten worden gebruikt voor ligatie B
  • 49 Incubeer beide ligatiereacties bij 4 ° C gedurende 16 – 20 uur.
  • 50 Stel de tweede stap van ligatie in. Combineer de bovenstaande twee ligatiereacties in een nieuwe buis van 1,7 ml. Vul de reacties aan met 16 L nuclease-vrij water, 2 L T4 DNA-ligase en 2 L 10× ligatiebuffer tot 100 L. Meng de reacties grondig door de buis voorzichtig af te plakken.
  • 51 Incubeer de ligatiereactie bij 4 ° C gedurende nog eens 16 – 20 uur om het SARS-CoV-2-DNA van volledige lengte te produceren.

Zuiver de ligatieproducten

Tijdsduur 1,5 uur

  • 52 Voeg na ligatie 100 L fenol:chloroform:isoamylalcohol toe aan de ligatiereactie en meng de oplossing door meerdere keren op de buis te tikken.VOORZICHTIGHEIDOrganische reagentia zoals fenol:chloroform:isoamylalcohol, chloroform en isopropanol zijn giftig. Chemische zuurkast is vereist voor het hanteren van dergelijke chemicaliën.
  • 53 Centrifugeer het mengsel bij maximale snelheid gedurende 1 minuut in een benchtop centrifuge.
  • 54 Controleer na het centrifugeren of er zich twee lagen hebben gevormd (de waterige fase bovenaan en de organische fase onderaan). Breng de waterige fase (80 L) met de DNA’s voorzichtig over in een afzonderlijke Eppendorf-buis van 1,7 ml.KRITIEKE STAPZorg ervoor dat u de organische fase niet overdraagt, die de stroomafwaartse RNA-transcriptie zou verslechteren.
  • 55 Voeg 100 L nuclease-vrij water toe aan de buis met de organische fase. Meng de oplossing door meerdere keren op de buis te tikken. Herhaal stap 52 en 53.
  • 56 Combineer de waterige fase verzameld uit de bovenstaande twee extracties. Voeg een gelijk volume chloroform (~ 200 L) toe aan de waterige fase die DNA’s bevat.
  • 57 Meng voorzichtig door meerdere keren op de tube te tikken. Centrifugeer de buis in een benchtop centrifuge op maximale snelheid gedurende 1 minuut.
  • 58 Breng de bovenste waterfase (~ 200 L) over naar een nieuwe buis van 1,7 mL.
  • 59 Voeg natriumacetaat (3,0 M, pH 5,2) toe aan de DNA-oplossing tot een eindconcentratie van 0,3 M.
  • 60 Voeg een gelijk volume isopropanol toe en meng voorzichtig door de buis meerdere keren om te keren.KRITIEKE STAPHet is belangrijk om DNA bij kamertemperatuur te precipiteren met isopropanol in plaats van ethanol om coprecipitatie van adenosinetrifosfaat (ATP) in de T4-ligatiebuffer te minimaliseren. Hoge aanwezigheid van ATP zou interfereren met DNA-kwantificering en stroomafwaartse in vitro transcriptie.
  • 61 Incubeer de mengsels bij kamertemperatuur gedurende 15-30 min om DNA te precipiteren.
  • 62 Pellet het DNA door centrifugeren op maximale snelheid gedurende 15 minuten bij kamertemperatuur in een benchtop centrifuge om DNA te pelleteren.
  • 63 Decanteer het supernatant voorzichtig.KRITIEKE STAPDe pellet kan naar buiten komen met het supernatant. Om verlies van de pellet tijdens het decanteren te voorkomen, bewaart u het supernatant in een nieuwe buis totdat u zeker weet dat het geprecipiteerde DNA is teruggevonden.
  • 64 Voeg 1 ml 70% ethanol toe aan de pellet. Centrifugeer bij maximale snelheid gedurende 5 minuten bij kamertemperatuur en giet het supernatant voorzichtig af.KRITIEKE STAPDe pellet kan naar buiten komen met het supernatant. Om verlies van de pellet tijdens het decanteren te voorkomen, bewaart u het supernatant in een nieuwe buis totdat u zeker weet dat het geprecipiteerde DNA is teruggevonden.
  • 65 Voeg 1 ml >95% ethanol toe aan de pellet. Centrifugeer bij maximale snelheid gedurende 2 minuten bij kamertemperatuur en giet het supernatant voorzichtig af.KRITIEKE STAPDe pellet kan naar buiten komen met het supernatant. Om verlies van de pellet tijdens het decanteren te voorkomen, bewaart u het supernatant in een nieuwe buis totdat u zeker weet dat het geprecipiteerde DNA is teruggevonden.
  • 66 Verwijder de resterende vloeistof voorzichtig volledig met een P100-pipet geladen met 100-μL-tips en droog de pellet gedurende <5 min.KRITIEKE STAPRaak de korrels niet aan. De pellet kan aan de punt blijven kleven.KRITIEKE STAPOverdrijf de pellet niet, omdat dit een lage terugwinning van het DNA kan veroorzaken.
  • 67 Voeg 10 L nuclease-vrij water (voorverwarmd op 56 ° C) toe om het DNA te resuspenderen.
  • 68 Wacht 1 minuut totdat de DNA’s volledig zijn opgelost. Tik zachtjes op de buis om het DNA te mengen. Draai de buis snel rond om alle vloeistof naar de bodem te brengen.
  • 69 Gebruik 0,5 – 1 μL monsters om de kwantiteit en kwaliteit van DNA te meten met een spectrometer. Breng de herstelde DNA-monsters over naar een nieuwe buis met DNA-laadkleurstof. De verwachte totale opbrengst van DNA-producten is ~ 3 g.
  • 70 Laad de herstelde DNA-monsters voor agarosegelelektroforese om het DNA van volledige lengte te onderzoeken. Het geligeerde SARS-CoV-2-DNA van volledige lengte moet worden gescheiden van andere DNA-fragmenten in een agarosegel van 0,8%, zoals weergegeven in figuur 2 .PAUZEPUNTDe gezuiverde DNA’s kunnen onmiddellijk worden gebruikt of tot gebruik maximaal een maand bij 4 °C worden bewaard.PROBLEEMOPLOSSEN

Bereiding van N-gen-DNA

Tijdstip 1 dag

KRITIEK

Co-elektroporatie met N-gen-RNA wordt in dit protocol gebruikt omdat N-eiwit de besmettelijkheid van coronavirus-RNA 5 , 6 , 24 kan verhogen . Het SARS-CoV-2 N-gen-cDNA wordt bereid uit het plasmide pCC1-CoV-2-F7 via PCR met een paar primers CoV-T7-NF (tactgTAATACGACTCACTATAGGatgtctgataatggacccaaaatc en polyT-NR [(t) 37 aggcctgagttgagtcagcac].

  • 71 Bereid PCR-reacties van 50 μL voor volgens de instructies van de Platinum SuperFI II PCR-mastermix. Bereid reacties voor als een masteroplossing van 200 L en verdeel de oplossing in vier PCR-buizen als 50 L per buis, zoals in de onderstaande tabel.PCR-reacties voor het amplificeren van N-genonderdeelVolume (μL)Nucleasevrij waterOpwaarderen tot 502× platina SuperFI II PCR-mastermix25Voorwaartse primer CoV-T7-NF2,5Reverse primer polyT-NR2,5Sjabloon-DNA (plasmide pCC1-CoV-2-F7)Nader te bepalen (1–10 van)
  • 72 Incubeer reacties in een thermische cycler volgens het thermische cyclusprogramma dat in de onderstaande tabel wordt beschreven.Thermisch cyclusprogramma voor PCRCyclusstapTemperatuurTijdCycliInitiële denaturatie98 °C30 euro1Denaturatie98 °C10 euro35 cycligloeien60 °C10 euro Verlenging72 °C20 euro Laatste verlenging72 °C5 minuten1 12 °CUitstel–
  • 73 Laad 1 μL PCR-product (gemengd met 6 × DNA-laadkleurstof) op een 0,8% agarosegel en controleer de PCR-producten door gelelektroforese. Gewoonlijk levert PCR een enkele DNA-band op met een grootte van 1.319 bp.
  • 74 Verduidelijk de PCR-producten met behulp van de Microspin G-25-kolommen volgens de instructies van de fabrikant om extra dNTP’s uit de PCR-reacties te verwijderen.
  • 75 Combineer alle vier verduidelijkte PCR-reacties (~ 200 μL) in een Eppendorf-buisje van 1,5 mL.
  • 76 Voeg 200 L fenol:chloroform:isoamylalcohol 25:24:1 toe. Meng de reacties door gedurende 5 s te vortexen.
  • 77 Centrifugeer bij> 12.000 rpm gedurende 1 minuut bij kamertemperatuur.
  • 78 Breng de bovenste waterige laag over naar een nieuwe 1,7 ml Eppendorf-buis.
  • 79 Voeg 100 L nuclease-vrij water toe aan de buis met fenol. Herhaal stap 76 en 77.
  • 80 Combineer de waterige fase verzameld uit de bovenstaande twee extracties. Voeg een gelijk volume chloroform (~ 250 L) toe aan de waterige fase die DNA’s bevat. Meng de reacties door gedurende 5 s te vortexen.
  • 81 Centrifugeer bij> 12.000 rpm gedurende 2 minuten bij kamertemperatuur. Verzamel de bovenste laag (~ 250 L) in een andere Eppendorf-buis van 1,7 ml.
  • 82 Voeg ~ 30 μL natriumacetaat (3,0 M, pH 5,2) toe aan de DNA-oplossing tot de eindconcentratie van 0,3 M.
  • 83 Voeg 900 L pure ethanol en 1,2 μL glycogeen toe. Meng door gedurende 5 s te vortexen.
  • 84 Incubeer de buis bij -20 ° C gedurende > 30 min.
  • 85 Centrifugeer de buis gedurende 15 minuten bij 4 ° C bij 14.000 rpm om het PCR-product te pelleteren.
  • 86 Was de pellet eenmaal met 70% ethanol.
  • 87 Verwijder de resterende vloeistof voorzichtig volledig met behulp van een P100-pipet geladen met 100-μL-tips en droog de pellet gedurende <5 min.
  • 88 Voeg 15 L nuclease-vrij water (voorverwarmd op 56°C) toe om het DNA te resuspenderen.
  • 89 Wacht 1 minuut totdat het DNA volledig is opgelost. Tik zachtjes op de buis om het DNA te mengen. Draai de buis snel rond om alle vloeistof naar de bodem te brengen.
  • 90 Gebruik 0,5 – 1 μL monsters om de kwantiteit en kwaliteit van DNA te meten met behulp van een spectrometer. Breng de herstelde DNA-monsters over naar een nieuwe buis met DNA-laadkleurstof.
  • 91 Laad de herstelde DNA-monsters voor agarosegelelektroforese om de kwaliteit van het gezuiverde DNA te onderzoeken.PAUZEPUNTDe gezuiverde DNA’s kunnen onmiddellijk worden gebruikt of tot gebruik worden bewaard bij -20 ° C.PROBLEEMOPLOSSEN

Fase 4: Bereid RNA van volledige lengte en N-gen-RNA voor door in vitro transcriptie

In vitro transcriptie

Tijdstip 1 dag

KRITIEK

Gebruik mMESSAGE mMACHINE T7 transcriptiekit om SARS-CoV-2 en N-proteïne RNA te genereren

  • 92 Stel de in vitro transcriptiereacties in zoals weergegeven in de onderstaande tabel.Opstelling van in vitro transcriptiereactieonderdeelVoor het transcriberen van RNA van volledige lengteVoor het transcriberen van N-RNA2× NTP/CAP25 L10 LGTP7,5 L0,75 μL10× reactiebuffer5 L2 LDNA-sjabloonTot 7,5 μL (gebruik 1-2 μg)TBD (gebruik 1 g)Enzym mix5 L2 LNucleasevrij waterOpwaarderen tot 50 μLOpwaarderen tot 20 μL
  • 93 Incubeer de reacties voor het transcriberen van SARS-CoV-2 full-length RNA bij 32 ° C gedurende 8 uur. Incubeer de reacties voor het transcriberen van SARS-CoV-2 N RNA bij 37 ° C gedurende 3 uur.
  • 94 Voeg 1-2 L DNase toe om de DNA-sjablonen gedurende 15 minuten bij 37 °C te verteren.
  • 95 Extraheer en zuiver het RNA met behulp van zure fenol:chloroform volgens de instructies van de mMESSAGE mMACHINE T7-transcriptiekit.
  • 96 Na isopropanol precipitatie en 70% ethanol wassen, resuspendeer de pellet met 20-50 L nuclease-vrij water.
  • 97 Meet de kwantiteit en kwaliteit van DNA met behulp van een spectrometer en laad 1 L RNA-monsters op een 0,8% agarosegel om de kwaliteit van RNA te onderzoeken (Fig. 2b ).
  • 98 Aliquot SARS-CoV-2 RNA en N-RNA van volledige lengte in PCR-buizen (20 μg per buis) en bewaar RNA-monsters bij -80 °C.PROBLEEMOPLOSSEN

Fase 5: Elektroporatie en virusproductie

Timing 1 uur voor elektroporatie en 2-4 d voor het herstellen van virussen

KRITIEK

In deze sectie wordt beschreven hoe u het SARS-CoV-2-recombinante virus uit celkweek kunt herstellen via RNA-elektroporatie. Twee verschillende methoden met alleen Vero E6-cellen (optie A) of BHK-21-cellen en Vero E6-cellen (optie B) worden afzonderlijk beschreven. In optie B worden RNA-transcripten geëlektroporeerd in BHK-21-cellen en worden de geëlektroporeerde BHK-cellen gezaaid op een monolaag van Vero E6-cellen. De stappen met betrekking tot celcultuur moeten worden uitgevoerd in een steriele omgeving in een bioveiligheidskast.

  1. 99Herstel het SARS-CoV-2-recombinante virus uit celcultuur via RNA-elektroporatie met behulp van Vero E6-cellen (optie A) of BHK-21-cellen (optie B).
    1. (EEN)Elektroporatie met alleen Vero E6-cellen
      1. (i)Splits Vero E6-cellen 1 d vóór elektroporatie om de volgende dag 80-90% samenvloeiing te garanderen. Zaad cellen in een T-175 kolf en kweek cellen in een 37 ° C incubator met 5 % CO2 . Gewoonlijk is één T-175-kolf met cellen voldoende om elektroporatie van twee monsters uit te voeren.KRITIEKCellen die in het BSL-2-lab worden bewaard, moeten vóór elektroporatie worden gecontroleerd op mycoplasma-besmetting. De elektroporatie- en celkweekstappen moeten strikt worden uitgevoerd in BSL-3-laboratoria. Gebruik verse cellen met 80-90% confluentie voorafgaand aan elektroporatie om ervoor te zorgen dat cellen zich in de exponentiële groeifase bevinden. Het gebruik van cellen die te confluent en/of oud zijn, kan resulteren in een lage transfectie-efficiëntie en een lage levensvatbaarheid van de cellen na elektroporatie.
      2. (ii)Maak vóór elektroporatie de volgende reagentia en apparatuur gereed:
        • Verwarm PBS, 0,25% trypsine-EDTA en celgroeimedium in een waterbad van 37 °C.
        • Koel een kuvet van 4 mm en een fles PBS voor op ijs.
        • Ontdooi 20 g SARS-CoV-2 en 20 μg N RNA op ijs.
        • Koel de centrifuge af tot 4 °C.
      3. (iii)Verwijder celkweekmedia uit de T175-kolf met behulp van VACUBOY.
      4. (iv)Voeg 12 mL warme PBS toe om de celmonolaag tweemaal te wassen.KRITIEKE STAPVero E6-cellen zijn gemakkelijk los te maken. Pipetteer PBS niet tegen celmonolaag.
      5. (v)Gooi PBS weg en voeg 4 ml warme 0,25% trypsine-EDTA toe aan de kolf.
      6. (vi)Incubeer de kolf bij 37 ° C gedurende 1 minuut om cellen los te maken van de kolf.
      7. (vii)Voeg 12 mL kweekmedium toe, aangevuld met 10% FBS om de activiteiten van trypsine te neutraliseren.
      8. (viii)Pipetteer de celsuspensie voorzichtig meerdere keren om een ​​eencellige suspensie te maken.
      9. (ix)Breng de celsuspensie over in een Falcon-buis van 50 mL.
      10. (x)Was de kolf nog een keer met 12 ml kweekmedium. Verzamel zoveel mogelijk cellen.
      11. (xi)Pellet de cellen door centrifugeren bij 420 g gedurende 5 minuten bij 4 ° C.
      12. (xii)Gooi het supernatant weg en resuspendeer de cellen in 20 mL gekoelde PBS.KRITIEKE STAPHoud de cellen op ijs voor elektroporatie.
      13. (xiii)Neem 30 L celsuspensie voor celtelling door cellen te mengen met een gelijk volume Trypan-blauw in een EP-buis van 1,7 ml.
      14. (xiv)Tel de celaantallen met behulp van Bio-Rad geautomatiseerde celteller.
      15. (xv)Bereken het totale aantal cellen voor elektroporatie (8 miljoen cellen per elektroporatie) en gooi eventuele extra cellen weg.
      16. (xvi)Pellet de cellen door centrifugeren bij 420 g gedurende 5 minuten bij 4 ° C.
      17. (xvii)Resuspendeer de celpellet met 0,8 ml gekoelde (4 ° C) elektroporatiebuffer. De concentratie van de cellen moet ~ 107 cellen per ml zijn.
      18. (xviii)Voeg in BSL-3 20 g SARS-CoV-2 RNA van volledige lengte en 20 μg N-eiwit-RNA toe aan de gekoelde cuvet van 4 mm.KRITIEKE STAPElektroporatie moet worden uitgevoerd in een bioveiligheidskast in BSL-3.
      19. (xix)Voeg 800 L celsuspensie toe en meng voorzichtig door op en neer te pipetteren.KRITIEKE STAPProbeer bij het mengen van cellen met RNA’s de vorming van luchtbellen in de cuvet te voorkomen.
      20. (xx)Plaats de cuvette snel in het Gene Pulser Xcell-elektroporatiesysteem en pas een enkele elektrische puls toe met een instelling van 270 V bij 950 μF (zie apparatuurconfiguratie voor meer informatie). Houd de Shockpod in de kap en de rest van de elektroporator buiten de kap.
      21. (xxi)Plaats de cuvet na elektroporatie gedurende 5 minuten bij kamertemperatuur om de cellen te herstellen.
      22. (xxii)Zuig de cellen voorzichtig uit de cuvette en breng de cellen over in een nieuwe T75-kolf met 15 ml kweekmedium aangevuld met 10% FBS.
      23. (xxiii)Kantel de kolven voorzichtig naar links en rechts om de cellen gelijkmatig te verdelen.
      24. (xxiv)Incubeer de cellen in een incubator van 37 °C met 5 % CO2 .
      25. (xxv)Verander de volgende dag de kweekmedia in vers medium aangevuld met 2% FBS.
      26. (xxvi)Controleer de cellen dagelijks op virus-gemedieerd cytopathisch effect (CPE). Voor recombinant wild-type (WT) SARS-CoV-2 zal naar verwachting 24-48 uur na elektroporatie een kleine CPE optreden. Ernstige CPE treedt op 48-72 uur na transfectie. WT SARS-CoV-2 van elektroporatie (gedefinieerd als P0-virus) wordt meestal ~ 40-60 uur na transfectie geoogst.
      27. (xxvii)Oogst P0-virus door centrifugeren bij 1000 g gedurende 10 minuten bij 4 ° C. Aliquot het P0-virus als 500 L per buis en bewaar de virussen in de vriezer van −80 °C voor toekomstig gebruik.
      28. (xxviii)Zaad 50-100 L P0 voorraad virus in een T175 kolf van Vero E6 monolagen.
      29. (xxix)Oogst de supernatanten 48 uur na infectie (gedefinieerd als P1) door centrifugeren bij 1000 g gedurende 10 minuten bij 4 ° C. Aliquot het P1-virus als 500 – 1.000 L per buis. Bewaar de virussen maximaal 1 jaar in de vriezer van −80 °C.
    2. (B)Elektroporatie met BHK-21-cellen en Vero E6-cellenKRITIEKRNA-transcripten worden geëlektroporeerd in BHK-21-cellen en de geëlektroporeerde BHK-cellen worden uitgezaaid op een monolaag van Vero E6-cellen. Deze benadering resulteert in een hogere transfectie-efficiëntie en een betere levensvatbaarheid van de cellen na elektroporatie dan het gebruik van alleen Vero E6-cellen.
      1. (i)Bereid twee T75-kolven met Vero E6-cellen en drie T75-kolven met BHK-21-cellen voor op 80-90% confluent bij elektroporatie. BHK-21-cellen worden gehandhaafd in MEM Alpha (1×) aangevuld met Glutamax, 5% FBS en 1% antibiotica. Vero E6-cellen worden gekweekt in DMEM-media die 10% FBS en 1% antibiotica bevatten.
      2. (ii)Vervang vóór elektroporatie de kweekmedia van Vero E6-kolven door 8 mL verse media met 5% FBS en 1% antibiotica.
      3. (iii)Oogst BHK-21-cellen uit alle acht kolven met dezelfde procedures als beschreven in optie A (alleen met Vero E6-cellen).
      4. (iv)Resuspendeer de BHK-21 celpellet in 2 mL koude PBS.KRITIEKE STAPHoud BHK-21-cellen en RNA’s overal op ijs.
      5. (v)Meng in een BSL3-lab 20 g N-eiwit-RNA, 20 μg SARS-CoV-2 RNA met 800 μL BHK-21-cellen in de gekoelde cuvette. Meng voor het controlemonster 20 g N-eiwit-RNA met 800 μL BHK-21-cellen in een aparte cuvet.
      6. (vi)Stel het exponentiële protocol in de elektroporator in met de volgende parameters: spanning (V): 850; capaciteit: 25 µF; weerstand: ; cuvet (mm): 4.
      7. (vii)Houd de Shockpod in de kap en de rest van de elektroporator buiten de kap. Plaats de controlecuvet in de Shockpod en geef drie pulsen met een interval van 3 s tussen elke puls.
      8. (viii)Incubeer de geëlektroporeerde cellen gedurende 5 minuten bij kamertemperatuur.
      9. (ix)Zuig de cellen voorzichtig uit de cuvette en breng ze over naar een 15 ml buis met 2 ml Vero E6 kweekmedia.
      10. (x)Breng de celsuspensie over naar elke Vero E6-kolf.
      11. (xi)Kantel de kolven om de cellen te verdelen en incubeer bij 37 °C met CO 2 totdat CPE verschijnt (meestal op dag 3 of 4).PROBLEEMOPLOSSEN

Fase 6: virale sequencing van het hele genoom

Tijdstip 2-3 dagen

Virale RNA-extractie

Tijdsduur 2 uur

  • 100 Voeg in een BSL-3-lab 200 L virusmonster toe aan een 2-mL O-ring afgedekte buis met 1.000 μL TRIzol LS-reagens.KRITIEKE STAPBuisjes die worden gebruikt om viraal RNA te verzamelen, moeten zijn uitgerust met schroefdeksels en afdichtringen om lekkage van het virus te voorkomen.
  • 101 Schroef het deksel stevig vast en meng de kweekvloeistof en TRIzol LS grondig. Plaats de buis gedurende 5 minuten bij kamertemperatuur om verstoring van het virus mogelijk te maken.PAUZEPUNTDe geïnactiveerde monsters van TRIzol LS kunnen gedurende 1 jaar bij -80 °C worden bewaard zonder RNA-degradatie.
  • 102 Breng de monsters na zorgvuldige oppervlakteontsmetting naar het BSL-2-lab voor stroomafwaartse verwerking.
  • 103 Isoleer RNA door de instructies van het TRIzol LS-reagens te volgen.
  • 104 Los ten slotte het geëxtraheerde RNA op in 15 μL nuclease-vrij water.PAUZEPUNTHet geëxtraheerde RNA kan onmiddellijk worden gebruikt of worden bewaard bij -80°C voor toekomstig gebruik (tot enkele maanden).

RT-PCR en Sanger-sequencing

Tijdsduur 5 uur

  • 105 Synthetiseer het cDNA van de eerste streng van 11 μL geïsoleerd RNA met behulp van SuperScript IV reverse transcriptase (volgens de instructies van de fabrikant). Willekeurige hexameren die in de kit worden geleverd, worden gebruikt als primers voor de omgekeerde transcriptie. Een totaal van 20 L eerste streng cDNA moet worden verkregen.PAUZEPUNTHet cDNA kan onmiddellijk worden gebruikt of worden bewaard bij -20 ° C voor toekomstig gebruik.
  • 106 Negen DNA-fragmenten (gF1 tot gF9) die het hele genoom van SARS-CoV-2 beslaan, worden door PCR geamplificeerd met behulp van de Platium SuperFi II DNA-polymerase-masteroplossingen. Bereid voor elk fragment geamplificeerd door PCR een reactie van 50 L voor met 2 L cDNA-sjabloon en een paar specifieke primers. De negen primerparen die voor elke fragmentamplificatie zijn gebruikt, worden in de onderstaande tabel getoond.Primers en gloeitemperatuur voor PCRFragmentgF1gF2gF3gF4gF5gF6gF7gF8gF9Voorwaartse primer (in 10 M)cov-1Vcov-3225Vcov-7382Vcov-11707Vcov-14618Vcov-18037Vcov-21521Vcov-25068Vcov-27875VOmgekeerde primer (in 10 M)pncov-R1pncov-F2m-Rpncov-R3cov-14995Rcov-18377Rpncov-R5cov-25238Rcov-28099Rpncov-R7Onthardingstemperatuur58 °C58 °C59 °C59 °C54 °C55 °C55 °C55 °C58 °CAmplicon-grootte (basenparen)3,6 kb4,3 kb4,6 kb3,2 kb3,8 kb4,02 kb3,7 kb3,0 kb2,0 kbDe nucleïnezuursequenties van negen primerparen voor PCR worden in de volgende tabel getoond.Primer naamVolgorde (5′-3′)cov-1VATTAAAGGTTTATACCTTCCCAGGpncov-R1GGGCCGACAACATGAAGACAGTGcov-3225VCTGTTGGTCAACAAGACGGpncov-F2m-RCTATTACGTTTGTAACACATCATACATGTAGATGAATTACcov-7382VCAAATGGCCCCGATTTCAGpncov-R3CAAAGGCTTCAGTAGTATCTTTAGCcov-11707VAGTTTCTACACAGGAGTTTAGcov-14995RTGGAAACCAGCTGATTTGTCcov-14618VCTACGTGCTTTTCAGTAGcov-18377RGTAGAAAAAACCTAGCTGTAAAGGcov-18037VAAGCTGAAAATGTAACAGGpncov-R5TCGCACTAGAATAAACTCTGAACTCcov-21521VTGTTATTTCTAGTGATGTTCTTGcov-25238RCAATCAAGCCAGCTATAAAACCcov-25068VTCTCTGGCATTAATGCTTCcov-28099RGATTTAGAACCAGCCTCATCCcov-27875VTTGTCACGCCTAAACGAACpncov-R7TTTTTTTTTTTTTGTCATTCTCCTAAAGAGCKRITIEKE STAPEen DNA-polymerase met hoge betrouwbaarheid wordt gebruikt om fouten tijdens DNA-amplificatie te voorkomen.
  • 107 Om de grootte van PCR-producten te controleren, voert u 1 L van elk fragment uit in een 0,8% agarosegel. Afbeelding van de gel met behulp van een Gel DOC-EZ imager. De verwachte banden worden getoond in Fig. 4 .Fig. 4: Negen PCR-amplicons bereid voor Sanger-sequencing.figuur 4De DNA-ladders (bp) worden getoond.Afbeelding op volledige grootte
  • 108 Zuiver de PCR-producten met behulp van de QIAquick PCR-zuiveringskit volgens de instructies van de fabrikant.
  • 109 Elueer het uiteindelijke DNA in 60 L nucleasevrij water (voorverwarmd bij 56 ° C) en bepaal de concentratie met behulp van een spectrometer.PAUZEPUNTHet cDNA kan onmiddellijk worden gebruikt of worden bewaard bij -20 ° C voor toekomstig gebruik.
  • 110 Bereid DNA en primers voor voor Sanger-sequencing (uitbesteed of intern uitgevoerd). Tabel 2 geeft een overzicht van de primers voor Sanger-sequencing van overeenkomstige DNA-fragmenten.Tabel 2 Sequentie-primerlijstTafel op ware grootte

Probleemoplossen

Advies voor het oplossen van problemen vindt u in Tabel 3 .Tabel 3 Tabel voor probleemoplossing

Tafel op ware grootte

timing

  • Stadium 1, vermeerdering van plasmiden die SARS-CoV-2-fragmenten bevatten
  • Stappen 1-10, chemische transformatie: 2 h
  • Stappen 11-15, koloniescherm: 1 d of ‘s nachts
  • Stappen 16–20, plasmide Miniprep: 1-2 uur
  • Stappen 21-25, plasmidevalidatie door restrictie-enzymdigestie: 2 uur
  • Stappen 26-34, plasmide Maxiprep: 24 uur
  • Fase 2, bereid DNA-fragmenten voor door restrictie-enzymdigestie en -zuivering
  • Stappen 35-37, plasmide verteren: 4 uur
  • Stappen 38–46, extractie van DNA-fragmenten uit gel: 2 uur
  • Stadium 3, in vitro ligatie
  • Stappen 47-51, in vitro ligatiereacties opzetten: 2 d
  • Stappen 52-70, ligatieproducten zuiveren: 1,5 h
  • Stappen 71-91, voorbereiding van N-gen-DNA: 1 d
  • Fase 4, bereid RNA van volledige lengte en N-gen-RNA voor door in vitro transcriptie
  • Stappen 92-98, in vitro transcriptie: 1 d
  • Fase 5, elektroporatie en virusproductie
  • Stap 99, 1 uur voor elektroporatie en 2-4 d voor het herstellen van virussen
  • Stadium 6, virale sequentiebepaling van het hele genoom
  • Stappen 100–104, virale RNA-extractie: 2 h
  • Stappen 105–110, RT-PCR en Sanger-sequencing: 5 uur

Verwachte resultaten

Dit protocol produceert efficiënt recombinante SARS-CoV-2-virussen. Het herstelde virus kan aanzienlijke CPE veroorzaken op Vero E6 (Fig. 5a ). De gemanipuleerde moleculaire markers zonder andere mutaties worden behouden in het recombinante SARS-CoV-2-genoom (Fig. 5b ). Het recombinante virus kan vergelijkbare plaquemorfologieën en replicatiekinetiek genereren als de klinische isolaatstam WA1 op Vero E6-cellen 3 .

figuur 5
Fig. 5: Karakterisering van recombinant SARS-CoV-2.

Rapportageoverzicht

Meer informatie over onderzoeksopzet is beschikbaar in de Nature Research Reporting Summary die aan dit artikel is gekoppeld.

Beschikbaarheid van data

Gegevens die het gebruik van dit protocol ondersteunen, zijn gerapporteerd in eerdere publicaties 3 . De zeven plasmiden van SARS-CoV-2 zijn gedeponeerd bij het World Reference Center for Emerging Viruses and Arboviruses ( https://www.utmb.edu/wrceva ) bij UTMB voor distributie.

Referenties

  1. Gralinski, LE & Menachery, VD Terugkeer van het coronavirus: 2019-nCoV. Virussen https://doi.org/10.3390/v12020135 (2020).
  2. Muruato, AE et al. Een neutraliserende antilichaamtest met hoge doorvoer voor COVID-19-diagnose en vaccinevaluatie. nat. gemeenschappelijk. 11 , 4059 (2020).Artikel CAS Google geleerde 
  3. Xie, X. et al. Een infectieuze cDNA-kloon van SARS-CoV-2. Celgastheermicrobe 27 , 841-848 e843 (2020).Artikel CAS Google geleerde 
  4. Xie, X. et al. Een nanoluciferase SARS-CoV-2 voor snelle neutralisatietests en screening van anti-infectieuze geneesmiddelen voor COVID-19. nat. gemeenschappelijk. 11 , 5214 (2020).Artikel CAS Google geleerde 
  5. Yount, B. et al. Omgekeerde genetica met een infectieus cDNA van volledige lengte van het coronavirus met ernstig acuut respiratoir syndroom. Proc. Natl Acad. Wetenschap. VS 100 , 12995-13000 (2003).Artikel CAS Google geleerde 
  6. Yount, B., Denison, MR, Weiss, SR & Baric, RS Systematische assemblage van een infectieus cDNA van volledige lengte van muizenhepatitisvirusstam A59. J. Virol. 76 , 11065-11078 (2002).Artikel CAS Google geleerde 
  7. Yount, B., Curtis, KM & Baric, RS Strategie voor systematische assemblage van grote RNA- en DNA-genomen: overdraagbaar gastro-enteritisvirusmodel. J. Virol. 74 , 10600-10611 (2000).Artikel CAS Google geleerde 
  8. Harcourt, J. et al. Ernstig acuut respiratoir syndroom coronavirus 2 van patiënt met 2019 nieuwe coronavirusziekte, Verenigde Staten. Ontstaan. Infecteren. Dis . https://doi.org/10.3201/eid2606.200516 (2020).
  9. Johnson, BA et al. Furine-splitsingsplaats is de sleutel tot de pathogenese van SARS-CoV-2. Preprint op bioRxiv https://doi.org/10.1101/2020.08.26.268854 (2020).
  10. Plante, JA et al. Spike-mutatie D614G verandert de SARS-CoV-2-fitness. Natuur https://doi.org/10.1038/s41586-020-2895-3 (2020).
  11. Almazan, F. et al. Omgekeerde genetische systemen van het coronavirus: infectieuze klonen en replicons. Virusres. 189 , 262-270 (2014).Artikel CAS Google geleerde 
  12. Becker, MM et al. Synthetisch recombinant vleermuis SARS-achtig coronavirus is besmettelijk in gekweekte cellen en in muizen. Proc. Natl Acad. Wetenschap. VS 105 , 19944-1949 (2008).Artikel CAS Google geleerde 
  13. Menachery, VD et al. Een SARS-achtige cluster van circulerende vleermuiscoronavirussen vertoont potentieel voor menselijke opkomst. nat. Med. 21 , 1508-1513 (2015).Artikel CAS Google geleerde 
  14. Menachery, VD et al. SARS-achtige WIV1-CoV klaar voor menselijke opkomst Proc. Natl Acad. Wetenschap. VS 113 , 3048-3053 (2016).Artikel CAS Google geleerde 
  15. Scobey, T. et al. Omgekeerde genetica met een infectieus cDNA van volledige lengte van het coronavirus van het ademhalingssyndroom in het Midden-Oosten. Proc. Natl Acad. Wetenschap. VS 110 , 16157-16162 (2013).Artikel CAS Google geleerde 
  16. Sahin, U. et al. COVID-19-vaccin BNT162b1 wekt menselijke antilichaam- en TH1-T-celreacties op. Natuur 586 , 594-599 (2020).Artikel CAS Google geleerde 
  17. Mulligan, MJ et al. Fase I/II-studie van COVID-19 RNA-vaccin BNT162b1 bij volwassenen. Natuur 586 , 589-593 (2020).Artikel CAS Google geleerde 
  18. Walsh, EE et al. Veiligheid en immunogeniciteit van twee op RNA gebaseerde Covid-19-vaccinkandidaten. N. Engl. J. Med . https://doi.org/10.1056/NEJMoa2027906 (2020).
  19. Thi Nhu Thao, T. et al. Snelle reconstructie van SARS-CoV-2 met behulp van een synthetisch genomics-platform. Natuur 582 , 561-565 (2020).Artikel Google geleerde 
  20. Menachery, VD et al. Combinatieverzwakking biedt strategie voor levende verzwakte coronavirusvaccins. J. Virol . https://doi.org/10.1128/JVI.00710-18 (2018).
  21. Menachery, VD et al. MERS-CoV accessoire ORF’s spelen een sleutelrol bij infectie en pathogenese. mBio https://doi.org/10.1128/mBio.00665-17 (2017).
  22. Menachery, VD et al. Behandeling met trypsine ontgrendelt barrière voor zoönotische vleermuiscoronavirusinfectie. J. Virol . https://doi.org/10.1128/JVI.01774-19 (2020).
  23. Hou, YJ et al. SARS-CoV-2 reverse genetica onthult een variabele infectiegradiënt in de luchtwegen. Cel 182 , 1-18 (2020).Artikel Google geleerde 
  24. Curtis, KM, Yount, B. & Baric, RS Heterologe genexpressie van overdraagbare gastro-enteritisvirus-replicondeeltjes. J. Virol. 76 , 1422-1434 (2002).Artikel CAS Google geleerde 

Referenties downloaden

Dankbetuigingen

XX werd gedeeltelijk ondersteund door NIH5UC7AI094660. VDM werd ondersteund door NIH- en NIAID-beurzen AI153602 en AG049042, en STARs Award uitgereikt door het University of Texas System. P.-YS werd ondersteund door NIH-subsidies AI142759, AI134907, AI145617 en UL1TR001439, en prijzen van de Sealy & Smith Foundation, Kleberg Foundation, de John S. Dunn Foundation, de Amon G. Carter Foundation, de Gilson Longenbaugh Foundation en de Stichting Summerfield Robert.

Auteurs informatie

Opmerkingen van de auteur

  1. Deze auteurs droegen gelijkelijk bij: Xuping Xie, Kumari G. Lokugamage, Xianwen Zhang.

Auteurs en affiliaties

  1. Afdeling Biochemie en Moleculaire Biologie, Universiteit van Texas Medical Branch, Galveston, TX, VSXuping Xie, Xianwen Zhang, Antonio E. Muruato & Pei-Yong Shio
  2. Afdeling Microbiologie en Immunologie, Universiteit van Texas Medical Branch, Galveston, TX, VSKumari G. Lokugamage, Michelle N. Vu, Antonio E. Muruato & Vineet D. Menachery
  3. Instituut voor menselijke infectie en immuniteit, University of Texas Medical Branch, Galveston, TX, VSVineet D. Menachery & Pei-Yong Shio
  4. Centrum voor Biodefense & Emerging Infectious Diseases, University of Texas Medical Branch, Galveston, TX, VSVineet D. Menachery
  5. Sealy Institute for Vaccine Sciences, University of Texas Medical Branch, Galveston, TX, VSPei-Yong Shio
  6. Sealy Center for Structural Biology & Molecular Biophysics, University of Texas Medical Branch, Galveston, TX, VSPei-Yong Shio
  7. Afdeling Farmacologie & Toxicologie, Universiteit van Texas Medical Branch, Galveston, TX, VSPei-Yong Shio

Bijdragen

XX, VDM en P.-YS ontwierpen en begeleidden het project en zorgden voor de financiering van het project. XX, KGL, XZ, MNV, VDM en P.-YS schreven het manuscript. Alle auteurs hebben het manuscript beoordeeld en goedgekeurd.

corresponderende auteurs

Correspondentie met Vineet D. Menachery of Pei-Yong Shi .

Ethische verklaringen

Concurrerende belangen

XX, VDM en P.-YS hebben een patent aangevraagd op het omgekeerde genetische systeem van SARS-CoV-2 en verslaggever SARS-CoV-2. De reminerende auteurs verklaren geen concurrerende belangen.

Extra informatie

Peer review informatie Nature Protocols bedankt Jasper Chan en Ailong Huang voor hun bijdrage aan de peer review van dit werk.

Opmerking van de uitgever Springer Nature blijft neutraal met betrekking tot jurisdictieclaims in gepubliceerde kaarten en institutionele affiliaties.

Gerelateerde Links

Belangrijke referenties met behulp van dit protocol

Xie, X. et al. Cell Host Microbe 27 , 841-848 e843 (2020): https://doi.org/10.1016/j.chom.2020.04.004

Johnson, BA et al. Voordruk bij bioRxiv (2020): https://doi.org/10.1101/2020.08.26.268854

Plant, JA et al. Natuur (2020): https://doi.org/10.1038/s41586-020-2895-3

Aanvullende informatie

Aanvullende informatie

Aanvullend Fig. 1.

Rapportageoverzicht

Herdrukken en machtigingen

Over dit artikel

Citeer dit artikel

Xie, X., Lokugamage, KG, Zhang, X. et al. Engineering van SARS-CoV-2 met behulp van een omgekeerd genetisch systeem. Nat Protoc 16 , 1761-1784 (2021). https://doi.org/10.1038/s41596-021-00491-8

Citaat downloaden

deel dit artikel

Iedereen met wie u de volgende link deelt, kan deze inhoud lezen:Deelbare link ophalen

Geleverd door het Springer Nature SharedIt-initiatief voor het delen van inhoud

Onderwerpen

Dit artikel is geciteerd door

Laat een reactie achter

Het e-mailadres wordt niet gepubliceerd. Vereiste velden zijn gemarkeerd met *


            

            

                        
            
            
assignment_turned_in Registrations
No Registration form is selected.
(Click on the star on form card to select)
Please login to view this page.
Please login to view this page.
Please login to view this page.