Een CRISPR-Cas9 Gene Drive-systeem gericht op vrouwelijke voortplanting in de malariamug-vector Anopheles gambiae

Het onderstaande is reeds ingezet om, wat men hoopt, de malaria uit te roeien door de malaria mug zich zelf te laten uitroeien, doordat alle nakomelingen van deze mug mannelijk zullen zijn. Deze technologie kan gebruikt zijn in de spuit. Wat aannemelijk is als de mensen die deze genocide hebben geregisseerd daartoe in staat zijn. En het is toch makkelijk.

Een CRISPR-Cas9 Gene Drive-systeem gericht op vrouwelijke voortplanting in de malariamug-vector Anopheles gambiae

Andrew Hammond, Roberto Galizi, […] en Tony Nolan

Aanvullende artikelinformatie

Bijbehorende gegevens

Aanvullende materialen

Abstract

Gene-drive-systemen die super-Mendeliaanse overerving van een transgen mogelijk maken, hebben het potentieel om insectenpopulaties over een tijdsbestek van een paar jaar te wijzigen [AU geeft alstublieft een reële schatting, dit lijkt vaag]. We beschrijven CRISPR-Cas9-endonucleaseconstructies die functioneren als gene-drive-systemen in Anopheles gambiae , de belangrijkste vector voor malaria [AU:OK?]. We identificeerden drie genen ( AGAP005958 , AGAP011377 en AGAP007280) die een recessief vrouwelijk steriliteitsfenotype verlenen bij verstoring, en in elke locus CRISPR-Cas9-gen-drive-constructies invoegen die zijn ontworpen om elk gen te targeten en te bewerken [AU:OK?]. Voor elke beoogde locus zagen we een sterke gene drive op moleculair niveau, met transmissiesnelheden naar nakomelingen van 91 tot 99,6%. Populatiemodellering en kooi-experimenten geven aan dat een CRISPR-Cas9-construct gericht op een van deze loci, AGAP007280, voldoet aan de minimumvereiste voor een gene drive gericht op vrouwelijke voortplanting in een insectenpopulatie. Deze bevindingen zouden de ontwikkeling van gene drives kunnen versnellen om muggenpopulaties onder controle te houden tot niveaus die de overdracht van malaria niet ondersteunen.

Meer dan tien jaar geleden werden voor het eerst synthetische gene-drive-systemen voorgesteld die plaatsspecifieke endonucleasen gebruiken om eigenschappen in een populatie te verspreiden 1. Dit voorstel was aanvankelijk geïnspireerd door de werking van een klasse van natuurlijke zelfzuchtige genetische elementen, gevonden in veel eencellige organismen, genaamd Homing Endonuclease Genes (HEG’s). HEG-gecodeerde eiwitten kunnen een DNA-sequentie van 15-30 bp herkennen en splitsen. HEG’s bevinden zich in de DNA-herkenningssequentie, waardoor deze resistent is tegen verdere splitsing. Wanneer de HEG echter in contact komt met een chromosoom dat de ononderbroken herkenningssequentie bevat, wordt de dubbelstrengige breuk veroorzaakt door de splitsing vaak gerepareerd met behulp van het homologe chromosoom als sjabloon, waardoor een heterozygoot effectief wordt omgezet in een homozygoot in een proces dat bekend staat als ‘homing’. Door dit mechanisme kan de frequentie van een HEG snel toenemen in een populatie.2 . Een HEG die tot expressie wordt gebracht in de kiembaan van een mannelijke mug en die een kunstmatig geïntroduceerde herkenningsplaats herkent, vertoont hoge percentages super-Mendeliaanse overerving en dringt snel een gekooide populatie binnen 2 . De verhoogde transmissiesnelheid die wordt geboden door op endonuclease gebaseerde gene-drive-systemen zou theoretisch kunnen opwegen tegen de fitnesskosten die voortvloeien uit de splitsingsactiviteit en verstoring van de beoogde sites. Als aan deze voorwaarde wordt voldaan, kan een aandrijfconstructie zich door een populatie verspreiden totdat het een evenwichtsfrequentie bereikt, met een verminderde gemiddelde geschiktheid voor de populatie 1 .

Elke nuclease met een voldoende lange herkenningssequentie zou hypothetisch opnieuw kunnen worden ontworpen om te functioneren als een gene drive-systeem vergelijkbaar met een HEG, op voorwaarde dat het kan worden gemanipuleerd om een ​​specifieke genomische locus te herkennen en in te voegen. We hebben bijvoorbeeld eerder aangetoond dat modulaire nucleasen zoals zinkvingernucleasen of TALEN’s, waarvoor de DNA-bindingsspecificiteit van elke module goed is gekarakteriseerd, kunnen worden gecombineerd om te functioneren als een synthetisch egoïstisch element in Drosophila , zij het met een lage replicatiebetrouwbaarheid. vanwege hun repetitieve aard 3 . Meer recent, de ontwikkeling van het CRISPR/Cas9-systeem 4 – 6heeft het proces van engineering van nucleasen die specifieke genomische sequenties kunnen splitsen radicaal vereenvoudigd. Een gids-RNA (gRNA) dat complementair is aan een DNA-doelplaats stuurt de activiteit van het Cas9-endonuclease naar die sequentie, waardoor het mogelijk wordt om vrijwel elke gekozen DNA-sequentie te bewerken zonder de noodzaak om complexe eiwitengineering- en selectieprocedures uit te voeren. Naast toepassingen in genoombewerking, biedt de specificiteit en de flexibiliteit van het CRISPR/Cas9-systeem ongekende mogelijkheden om de ontwikkeling van gene-drive-systemen voor de bestrijding van vectoren van ziekten door insecten te versnellen7 In een bewijs van principe voor een dergelijk gebruik werd een op CRISPR gebaseerd construct gebruikt om gene drive in een enkele generatie aan te tonen op een oogkleurlocus in beide Drosophilaen gist met behulp van een gesplitst aandrijfsysteem 8 , 9 .

De vertaling van deze technologie voor de bestrijding van de insectenvector van menselijke malaria vereist de ontwikkeling van een op endonuclease gebaseerd gene drive-systeem dat het vermogen van A. gambiae – muggen om de ziekte over te dragen verstoort. Dit kan worden bereikt door de ontwikkeling van parasieten te blokkeren of door het voortplantingsvermogen van de insectenvector te verminderen. Modellering van vectorpopulaties geeft aan dat dit laatste kan worden bereikt door het gebruik van een endonuclease dat is ontworpen om een ​​recessieve mutatie in een gen te ‘thuisbrengen’ en voort te brengen dat essentieel is voor levensvatbaarheid of vrouwelijke vruchtbaarheid, waarbij de laatste effectiever is op voorwaarde dat homing tijdelijk is en ruimtelijk beperkt tot de kiembaan tijdens of voorafgaand aan het proces van gametenvorming 1 , 10. Dit is essentieel om somatische verstoring van het wildtype allel te voorkomen en de normale ontwikkeling van heterozygote muggen mogelijk te maken, cruciaal voor het doorgeven van het endonuclease aan de volgende generaties. Langs deze lijnen hebben we een CRISPR-gebaseerd gene drive-systeem ontwikkeld dat is ontworpen om homing uit te voeren in beide geslachten van de menselijke malariavector A. gambiae , gericht op haplosufficient somatisch tot expressie gebrachte vrouwelijke vruchtbaarheidsgenen.

Om vermeende vrouwelijke vruchtbaarheidsgenen in A. gambiae te identificeren , gebruikten we een combinatie van orthologie en een steriliteitsindex op basis van een logistisch regressiemodel dat genexpressiekenmerken correleerde met de waarschijnlijkheid van vrouwelijke steriele allelen in het model dipteran Drosophila melanogaster 11 , 12 . Uit deze analyse werden drie kandidaatgenen met hoge eierstokexpressie en weefselspecificiteit gekozen: AGAP005958 (ortholoog van Drosophila yellow-g , een haplosufficient vrouwelijk vruchtbaarheidsgen dat tot expressie wordt gebracht in somatische follikelcellen 13 ); AGAP007280 (ortholoog van Drosophila nudel, een haplosufficient vrouwelijk vruchtbaarheidsgen dat tot expressie wordt gebracht in somatische follikelcellen die betrokken zijn bij dorsoventrale patroonvorming van embryo 14 ); AGAP011377 (geen duidelijke Drosophila – ortholoog maar bevat een waarschijnlijk chitine-bindend domein).

We gebruikten CRISPR- of TALEN-nucleasen om selectief de coderende sequentie van deze kandidaatgenen te verstoren en reproductieve fenotypes te analyseren om de geschiktheid van deze genen als homing-doelen te valideren. De gen-knock-outstrategie genereerde “docking-lijnen” via homologe recombinatie waarbij een GFP-transcriptie-eenheid werd ingevoegd geflankeerd door twee attP-plaatsen die geschikt waren voor daaropvolgende insertie van actieve aandrijfconstructies (Afb. 1A). Hoewel het niet strikt noodzakelijk is voor het inbrengen van een gene drive-element, maakt het genereren van de koppelingslijnen een ondubbelzinnige beoordeling mogelijk van het fenotype veroorzaakt door genverstoring, bij afwezigheid van voortdurende Cas9-activiteit. In elk geval was het inbrengen van de attP-GFP-dockingcassette ontworpen om een ​​nulfenotype te produceren. Zowel TALEN- als Cas9-nucleasen waren effectief bij het knippen van de overeenkomstige doelsequenties en bij het bevorderen van de insertie van het koppelingsconstruct op de splitsingsplaats. Op elk van de drie geselecteerde doelloci werden getransformeerde GFP+-individuen teruggevonden met een relatief hoge frequentie met snelheden die op zijn minst vergelijkbaar zijn met onze ervaring met transposon-gemedieerde kiembaantransformatie ( Supp. Tabel 1) en ze werden bevestigd in PCR-experimenten om de gewenste homologe recombinatiegebeurtenissen te dragen (zie Supp. Fig. 1 ). [AU moet duidelijk worden gemaakt of uw methode VEREIST dat er een aanleglijn moet worden aangelegd, in de tekst a.u.b.] . G1  individuen van de koppelingslijnen waren vruchtbaar en werden onderling gekruist om G2-nakomelingen te produceren , waarvan verwacht wordt dat ze individuen omvatten die zowel heterozygoot als homozygoot zijn voor de insertie. Visuele inspectie van G2  nageslacht identificeerde twee klassen muggen op basis van GFP-intensiteit, ‘gemiddeld’ en ‘sterk’, die we toeschreven aan de aanwezigheid van één of twee kopieën van het GFP-gen in respectievelijk de heterozygote of homozygote toestand, en later bevestigd door moleculaire analyse (Afb. 1B). Vruchtbaarheidstesten (eieren leggen en uitkomen) uitgevoerd op individuele muggen toonden aan dat alle homozygote vrouwtjesmuggen steriel waren, terwijl heterozygote vrouwtjes normale eieren legden en uitkwamen (Afb. 1C). Op basis van deze resultaten concludeerden we dat de geselecteerde genen beschouwd moeten worden als geluksvoldoende vrouwelijke steriliteitsgenen. Manifestatie van het verminderde vruchtbaarheidsfenotype verschilde tussen de 3 beoogde genen, consistent met hun functie in verschillende stadia van eierproductie en embryo-ontwikkeling: homozygote vrouwtjes met twee verstoorde allelen van AGAP005958 of AGAP011377 konden geen eieren leggen, terwijl homozygote gemuteerde vrouwtjes bij AGAP007280 eieren legden die niet uitkwamen (zie Supp. Fig 2 ).

Figuur 1

Genverstoring door homologie gericht herstel op drie afzonderlijke loci veroorzaakt recessieve vrouwelijke onvruchtbaarheid.

Na het valideren van het fenotype van de vrouwelijke vruchtbaarheid van de doelgenen hebben we een gene-drive element ( CRISPR h ) (Afb. 1a) in de docking-site door recombinase-gemedieerde cassette-uitwisseling (RMCE) 15 . Elk drive-construct was ontworpen om bij beide geslachten thuis te komen in de verwante wildtype-locus en bevatte de volgende elementen: a) het Cas9-nuclease onder de controle van de vasa2- promoter, waarvan in een eerder rapport is aangetoond dat het actief is in de kiembaan van beide geslachten 16 ; b) een gRNA-sequentie die is ontworpen om de splitsingsactiviteit van het nuclease te richten op dezelfde sequentie die het doelwit is van de gen-knock-outexperimenten en onder de promoter van het alom tot expressie gebrachte, door PolIII getranscribeerde U6 – gen 17 ; en c) een visuele markering (3xP3::RFP). AttB-locaties die de CRISPR flankeren hconstruct werden gebruikt om ФC31 integrase-gemedieerde recombinatie naar de aanlegplaats te sturen. Zich bewust van het potentieel voor deze muggen om gene drive te vertonen, hebben we onze muggen gehuisvest in een insluitingsfaciliteit die in overeenstemming is met recente aanbevelingen voor veiligheidsmaatregelen in dergelijke experimenten 18 . Succesvolle cassette-uitwisselingsgebeurtenissen werden visueel geïdentificeerd onder Gi  nageslacht als GFP+ naar RFP+ fenotype-conversies, en bevestigd met behulp van PCR ( Supp. Fig. 3 ). [AU alle primersequenties moeten in uw definitieve paper worden opgenomen]. Op alle drie vrouwelijke vruchtbaarheidsloci herstelden we dubbele crossover-gebeurtenissen die resulteerden in cassette-uitwisseling en insertie van het CRISPR h -allel, bij transformatiefrequenties variërend van 2 tot 7% ​​(tafel 1). In de cassette-uitwisselingsreactie hebben we de insertie waargenomen van zowel volledige als onvolledige CRISPR h – allelen, de laatste waarschijnlijk het resultaat van intramoleculaire recombinatie tussen gebieden van homologie tussen het gids-RNA-construct en zijn endogene doelwit op de insertieplaats.

tafel 1

Recombinase-gemedieerde cassette-uitwisseling om CRISPR h – allelen op hun doellocus in te voegen

Elke volledige integratiegebeurtenis genereerde een CRISPR h -gemodificeerd allel dat codeert voor een Cas9-gRNA-endonuclease dat is ontworpen om zich te richten op de overeenkomstige integratieplaats op een wildtype chromosoom. Dienovereenkomstig was het CRISPR – h -allel resistent tegen nucleasesplitsing omdat de doelsequentie ervan was onderbroken door de insertie van het CRISPR h – construct zelf. Bij heterozygote muggen zou de activering van de vasa2- promoter tijdens de vorming van gameten de synthese van het Cas9-nuclease moeten induceren dat in samenwerking met het alomtegenwoordig tot expressie gebrachte gRNA de doelsequentie in de vruchtbaarheidsgenen zou moeten splitsen, waardoor homologe recombinatieherstelgebeurtenissen worden geïnitieerd die leiden tot de homing van de CRISPR hconstruct in het wildtype allel (Afb. 2A). Visuele screening werd gebruikt om de frequentie van het RFP-gekoppelde CRISPR h – allel te analyseren in het nageslacht van heterozygote ouders gekruist met wildtype muggen om tekenen van niet-Mendeliaanse overerving te detecteren boven de verwachte frequentie van 50% die gene drive-activiteit zou onthullen (Afb. 2B).

Figuur 2

CRISPR – h -allelen die zijn ingebracht op vrouwelijke vruchtbaarheidsloci vertonen een zeer efficiënte gene drive en kunnen zich verspreiden in een gekooide populatie

In verschillende van de CRISPR h /+ G 1 -individuen die we op elke locus terugvonden, zagen we super-Mendeliaanse overerving van het RFP-gemarkeerde CRISPR h – allel [AU zegt kort hoe dit duidelijk was], met percentages zo hoog als 94,4 -100% (tafel 1), onder het nageslacht. Om de activiteit van deze CRISPR- h – allelen verder te onderzoeken, hebben we gekeken naar het vermogen tot homing en steriliteit in de G2  generatie en daarna, waarbij we de nakomelingen van grote aantallen enkelvoudige kruisingen met wildtype muggen scoorden. Steevast zagen we hoge transmissiesnelheden in elke onderzochte vruchtbare kruising (Afb. 2C), wat neerkomt op gemiddelde homing-snelheden (gedefinieerd als het aandeel niet-CRISPR-allelen omgezet in CRISPR h in de gameten) variërend van 87,3% tot 99,3% voor de 3 doelgenen. Belangrijk is dat, hoewel we meer variabiliteit (69-98%) tussen generaties waarnamen, we geen duidelijke afname in homing-prestaties in de loop van de tijd constateerden (tafel 2), wat suggereert dat de meeste CRISPR-homing-gebeurtenissen een intact allel regenereren. Bovendien was de transmissiesnelheid van het CRISPR h -allel bij AGAP007280 en AGAP011377 hoog bij zowel mannelijke als vrouwelijke CRISPR h /+- individuen, in overeenstemming met de voorspelde activiteit van de vasa2- promoter bij beide geslachten tijdens de vroege gametogenese (Papathanos et al. 2008). In die zeldzame nakomelingen die geen CRISPR-homing-allel bevatten, zochten we naar bewijs van herstel door niet-homologe end-joining (NHEJ), microhomology-mediated end-joining (MMEJ) 19of andere niet-canonieke homing-evenementen op de drie doelloci. Van in totaal 32 nakomelingen afkomstig van minimaal 7 individuen vonden we in totaal 12 indel-mutaties (6 unieke, waaronder twee voorbeelden van een 6bp deletie die het leeskader behoudt en een resistent allel zou kunnen vertegenwoordigen), vermoedelijk voortkomend uit NHEJ of MMEJ reparatie, en twee gebeurtenissen van dezelfde ouder die een insertie van 171 bp produceren bij AGAP007280, het meest spaarzaam verklaard door een onvolledige homing-gebeurtenis die werd opgelost met behulp van homologie tussen de gRNA-sequentie in het construct en zijn verwante doelwit in het genoom (zie Supp Fig 4). In overeenstemming met zeldzame onvolledige homing-gebeurtenissen die een niet-functioneel homing-allel genereerden, hebben we een identieke gebeurtenis teruggevonden in een enkel individu dat nakomelingen produceerde met een normale Mendeliaanse segregatie van het transgene fenotype.

tafel 2

CRISPR h -homingpercentages blijven generaties lang hoog

Hoewel de homing-percentages hoog waren in de kiembaan van zowel mannetjes als vrouwtjes, was de vruchtbaarheid van vrouwtjes die heterozygoot waren voor een homing-construct aanzienlijk verminderd, met het aantal geproduceerde larven van slechts 4,6% van het wildtype (bootstrap 95% betrouwbaarheidsgrenzen 2,3-7,7% ) voor AGAP011377 en 9,3% (5,7–14,2%) van het wildtype voor AGAP007280. We hebben geen enkele larve teruggevonden van vrouwtjes die heterozygoot waren voor een CRISPR h -allel op AGAP005958 (Afb. 2D). Daarentegen vertoonden CRISPR h – allelen normale vruchtbaarheid in equivalente kruisingen van heterozygote mannetjes (Afb. 2E). De vermindering van de vruchtbaarheid die werd waargenomen bij heterozygote CRISPR h – vrouwen stond op gespannen voet met het fenotype dat werd waargenomen bij heterozygote koppellijnvrouwen waar de verstoring van enkele allelen van AGAP011377 , AGAP007280 en AGAP005958 blijkbaar geen invloed had op de vrouwelijke vruchtbaarheid. Deze vermindering van de vruchtbaarheid is waarschijnlijk het gevolg van somatische expressie van het Cas9-nuclease, zoals we hebben waargenomen voor een vergelijkbaar construct gericht op GFP ( Supp Fig.5 ), en zoals anderen hebben waargenomen in Drosophila 9 , 20 . In Drosophila , de nrsEr is onlangs ontdekt dat de promotor aanzienlijk meer kiembaanspecifiek is bij het aansturen van Cas9-activiteit 20 en ons systeem is flexibel om plaats te bieden aan alternatieve promotors.

Onze maten van homing rates en vruchtbaarheidseffecten kunnen worden gebruikt met het model van Deredec et al. (2008) om een ​​eerste voorspelling af te leiden over de vraag of de constructen zich naar verwachting zullen verspreiden als ze in een populatie worden vrijgegeven. Uit deze analyse bleek dat de fitnesskosten in termen van verminderd voortplantingsvermogen opgelegd door de CRISPR h – constructies op AGAP01377 en AGAP005958 zwaarder wegen dan de terugkeersnelheid, en dat de constructies naar verwachting in de loop van de tijd uit een populatie zullen verdwijnen – in veel opzichten voldoen deze constructies aan de vereisten van vrouwspecifieke RIDL (Release of Insects with a Dominant Lethal) met verbeterde transmissie 21, een krachtige vorm van de Sterile Insect Technique, hoewel voorwaardelijke redding van de steriliteit nodig kan zijn voor efficiënte productie. De hogere homing-snelheden die zijn waargenomen voor CRISPR h bij AGAP007280 in combinatie met de mildere vermindering van de vruchtbaarheid die is waargenomen bij heterozygote vrouwtjes, geven echter aan dat dit construct zich zou kunnen verspreiden door een populatie, althans aanvankelijk, en legde daarbij een reproductieve belasting op de populatie, waarmee werd voldaan aan een van de belangrijkste vereisten voor een functionele gene drive-maatregel voor vectorcontrole (Fig. 3A). Om het vermogen van het CRISPR – h -allel om zich te verspreiden op de AGAP007280-locus te onderzoeken, werden gekooide populaties geïnitieerd met CRISPR h/+ en wildtype individuen met een gelijke frequentie en gedurende verschillende generaties gevolgd. In overeenstemming met de modelleringsvoorspellingen zagen we een progressieve toename in de frequentie van individuen die positief waren voor het CRISPR h – allel van 50% naar 75,1% over 4 generaties (Fig. 3B). Een dergelijke reproductieve belasting zal een sterke selectiedruk opleggen voor resistente allelen, waarvan sommige door het systeem zelf zullen worden gegenereerd door NHEJ-reparatie van door endonuclease geïnduceerde chromosoombreuken, zoals we eerder moleculair hebben aangetoond ( Supp. Fig. 4 ). De dynamiek op langere termijn zal afhangen van de efficiëntie van verspreiding enerzijds en de fitnesskosten van mutaties die ontstaan ​​op de splitsingsplaats anderzijds 10 , 22. Uiteindelijk kan het effect van deze mutaties worden verzacht door nucleasen te ontwerpen die zich richten op geconserveerde, functioneel beperkte gebieden in het gewenste gen en die mutaties tolerant zijn 1 . In het geval van CRISPR kan dit worden bereikt door het gebruik van meerdere gids-RNA’s gericht op sequentievarianten 7 .

De hoge frequentie waarmee gen-uitschakelingen werden bereikt op drie afzonderlijke loci, en het gemak waarmee deze beide konden worden gevolgd met behulp van een visuele marker en secundair werden aangepast om genen naar keuze op te nemen [AU bedoel je het gebruik van genbewerking, zo ja, zeg het hier ], stelt een reproduceerbaar hulpmiddel voor het bewerken van genen vast dat uiterst waardevol zal zijn voor functionele genetica bij de malariamug. De percentages van super-Mendeliaanse overerving die we waarnemen met op CRISPR gebaseerde homing-constructen op loci voor vrouwelijke vruchtbaarheid vormen een solide basis voor de ontwikkeling van een gene drive-systeem dat het potentieel heeft om muggenpopulaties aanzienlijk te verminderen. Bovendien was ons gene drive-element in staat om substantiële extra sequenties te dragen in de vorm van de RFP-markereenheid, wat aangeeft dat deze technologie ook bestand is tegen het meenemen van extra vracht, waardoor het geschikt is voor populatiemodificatiestrategieën gericht op het modificeren van vectorpopulaties met transgenen die nuttige fenotypes verlenen, zoals parasietresistentie. AU zegt kort wat de volgende stappen zijn om de gene drive-technologie te verbeteren. Door CRISPR-Cas9 in muggen te kunnen gebruiken, zullen genoombewerking en nuclease-engineering niet langer technische knelpunten zijn bij dit belangrijke plaaginsect.

Het succes van gene drive-technologie voor vectorcontrole zal afhangen van de keuze van geschikte promoters om homing effectief aan te sturen tijdens het proces van gametogenese, het fenotype van de verstoorde genen, de robuustheid van het nuclease tijdens homing en het vermogen van de doelpopulatie om compenserende mutaties.

Online methoden

Keuze van doelgenen

Steriliteitsindex – p(steriel)

Om de waarschijnlijke effecten op steriliteit als gevolg van geninactivatie te beoordelen, hebben we een steriliteitsindex gemaakt met logistische regressiemodellen in Drosophila op basis van genexpressie en de gecorreleerde effecten van genetische klop voordat modelparameters op het Anopheles – genoom werden toegepast. De modellen zijn geanalyseerd met de statistische programmeertaal R ( www.r-project.org ).

Genexpressie

MozAtlas 11 en FlyAtlas 23 genexpressieschattingen werden verkregen voor zowel Anopheles- als Drosophila -sondesets . Om de genexpressie van Anopheles vergelijkbaar te maken met die van Drosophilawerden geslachtsspecifieke monsters samengevoegd en werd de maximale intensiteit geregistreerd in beide geslachten. Als er meerdere sondes aanwezig waren voor een gen, werd de expressie in elk weefsel berekend als maximale sonde-intensiteit, terwijl sondes die in meerdere genen aanwezig waren, werden weggelaten uit verdere analyse. Alleen probes die aangaven dat expressie ‘aanwezig’ was in ten minste 3 van de 4 biologische replica’s, werden in deze analyse opgenomen. Modellen werden geconstrueerd op basis van rang genormaliseerde genexpressie in de kop, karkas, testis en eierstok van Drosophilagenexpressie. Voor elk weefsel werd genexpressie gerangschikt van de laagste naar de hoogste expressie-intensiteit (banden kregen de minimale rang voor die groep genen) en gedeeld door het aantal genen in de dataset. Rang genormaliseerde waarden vallen tussen 0 en 1, wat het aandeel genen weergeeft met een lagere expressiewaarde in dat weefsel, een waarde van 0,8 geeft bijvoorbeeld aan dat 80% van de andere genen in dat weefsel een lager expressieniveau hebben. Weefselspecificiteit werd weergegeven door de tau-statistiek 24 . Expressie was in elk weefsel genormaliseerd tegen maximale expressie voor dat gen. Deze waarden worden gedeeld door het aantal weefsels (n-1) en vervolgens bij elkaar opgeteld. De waarde zal tussen 0 en 1 liggen. Een waarde van 1 is gelijk aan een specifieke expressie. Een waarde van 0 is gelijk aan alomtegenwoordige expressie.

Fenotype-annotaties

Fenotype-annotaties werden verkregen van FlyBase (2011_7) 25 ( Supp Tabel 1 ). Voor modellering werden annotaties geaccepteerd als het geassocieerde gen meer dan 10 allelen had of bewijs van een nul-steriele annotatie. In het bijzonder werden genen met meer dan 10 allelen, maar niet geannoteerd als steriel, in het model opgenomen als NIET-STERIEL (n=1509). Genen geannoteerd met een steriele identificator, en meer dan 10 allelen of bewijs van een nul-steriele mutatie werden opgenomen in modellen als STERIEL (n=536). De resterende genen bleven als ONBEKEND en werden niet opgenomen in de modellering (n=8886).

Logistieke regressie

De resultaten van de logistische regressie worden getoond inSupp. tafel 2. Het product (eierstok:tau) van gerangschikte eierstokexpressie en weefselspecificiteit had de hoogste correlatie met een vrouwelijke steriele annotatie. Nadat we de verkregen coëfficiënten voor Drosophila hadden uitgebreid naar de Anopheles- expressiedataset voor dezelfde weefsels, vonden we 271 Anopheles- genen met een ap(steriele) score ≥ 0,5 (de volledige lijst is te vinden inSupp. Tabel 4). We verwijzen naar de p(steriele) waarde van genen als de steriliteitsindex.

Aanvullende tabel 2

Steriliteitsaantekeningen en gecontroleerde woordenschat (FlyBase 2011_7)

Aanvullende tabel 4

P(steriel) van doelgenen

Generatie van donorconstructen voor gentargeting via CRISPR of TALEN gemedieerde HDR

Gen-targeting-vectoren werden geassembleerd door Gateway-klonen (Invitrogen) en ontworpen om een ​​door attP geflankeerd 3xP3::GFP-markerconstruct te bevatten dat is omsloten door homologie-armen die zich 2 kb uitstrekken in beide richtingen van de verwachte CRISPR h – splitsingsplaats, evenals een externe 3xP3::RFP markeerstift. Regio’s die de doelwitplaatsen voor elk gen flankeerden, waren geamplificeerde primers die de noodzakelijke recombinaseplaatsen voor de Gateway-reactie bevatten ( onderstreept ). For AGAP005958: 5958-T1[5’F1]B1 ( GGGGACAAGTTTGTACAAAAAAGCAGGCT GTGCAAGCTAGCCGTTTCGAG) and 5958-T1[5’R1]B4 ( GGGGACAACTTTGTATAGAAAAGTTG GGTGCGCGGCTCCAGTATCTCGTCA) as well as 5958-T1[3’F1]B3 ( GGGGACAACTTTGTATAATAAAGTTG AGCTGGATTTCACAATCTCCGA) and 5958-T1 [3’R1]B2 (GGGGACCACTTTGTACAAAAAGCTGGGT ACTCGTGCATTTGACTGCTTCC) om respectievelijk de linker- en rechterarm van homologie te genereren. Regio’s die de AGAP007280-doelsite flankeren, werden geamplificeerd met behulp van 7280-T1[5’F1]B1 ( GGGGACAAGTTTTGTACAAAAAAGCAGGCT CAGATACTGATGCCGCAGGTTCA) en 7280-T1[5’R1]B4 ( GGGGACAACTTTGTATAGAAAAGTTG GGTGGAAAGTGAGGAGGAGGGTGGTAGTG) evenals 7280-T-AT1[ 3’F1CAGTTGTGTCATTG TTTCTTCCTCACCTCGCTGCGA) en 7280-T1[3’R1]B2 ( GGGGACCACTTTGTACAAGAAAAGCTGGGT ACCCCTCCAGCTATGATCAACATGC) om respectievelijk de linker- en rechterarmen van homologie te genereren. Regio’s die de AGAP011377-doelsite flankeren, werden geamplificeerd met behulp van 11377-T1[5’F1]B1 ( GGGGACAAGTTTTGTACAAAAAAGCAGGCT CTAGTGGCTACAGGCAGGCC) en 11377-T1[5’R1]B4 (GGGGACAACTTTGTATAGAAAAGTTG GGTGGAAATTTTCCGGCGCCAGGC) evenals 11377-T1[3’F1]B3 ( GGGGACAACTTTGTATAATAAAGTTG TTTCTACGTCTGCTACAACG) en 11377-T1[3’R1]B2 ( GGGGACCACTTTGTACAAGAAAGCTGGGT AGACGAGTCAACTCCAGGGCT) om respectievelijk de linker- en rechterarm van homologie te genereren.

De geamplificeerde linker en rechter homologie-armen werden gekloneerd door BP-reactie (Invitrogen) in respectievelijk pDONR221-P1P4 en pDONR221-P3P2. De resulterende pENTR-vectoren werden geassembleerd tot donorvectoren (pHDRfp-11377; pHDRgfp-5958; pHDRgfp-7280) door LR-reactie (Invitrogen) met een attP-GFP-attP pENTR-vector en een bestemmingsvector die een 3xP3::RFP-marker extern aan de armen van de homologie die niet in de doellocus mogen worden ingebracht tijdens een legitieme op homologie gerichte herstelgebeurtenis.

Generatie van CRISPR- en TALEN-constructies

Een voor menselijke codons geoptimaliseerde versie van het Cas9-gen van Streptococcus pyogenes (hCas9) werd geamplificeerd uit pX330 (AddGene/Zhang lab) met behulp van primers die SalI- en PacI -plaatsen bevatten, SalI-hCas9-F (aacgtcgacGATCCCGGTGCCACCATGGA) en PacI-hCas9-R (aacttaattaaTTTCGTGGCCGCCGGCCTTTT) . hCas9 werd vervolgens gesubkloneerd met SalI en PacI in een vasa-promoter-bevattende vector voordat het werd gekloneerd in een RMCE-vector gesynthetiseerd door DNA2.0 om de vasa 3′ UTR-regulerende sequentie en een U6::gRNA-cassette te bevatten die een spacer-kloneringsplaats bevat op Hwang et al. 26 , allemaal geflankeerd door attB-recombinatieplaatsen. De U6snRNA-polymerase III-promoter- en terminatorsequenties werden gebruikt zoals eerder beschreven 17. De resulterende vector, p165, werd gedigereerd met BsaI en gemodificeerd om individuele gRNA-spacers te bevatten door golden gate-klonering van geschikt ontworpen en gehybridiseerde oligo’s die volledige homologie dragen met de bedoelde doelsequentie met unidirectionele overhangen die compatibel zijn met met BsaI gedigereerd p165. De volledige sequentie van vector p165 is gedeponeerd bij GenBank (BankIt ID 1873065). De resulterende vectoren die gRNA’s bevatten die gericht zijn op AGAP011377 (GCAGACGTAGAAATTTTC), AGAP005958 (GAGATACTGGAGCCGCGAGC) en AGAP007280 (GGAAGAAAGTGAGGAGGA) werden respectievelijk p16503, p16505 en p16501 genoemd. Individuele gRNA-doelsites werden geïdentificeerd en beoordeeld op off-targets met behulp van zowel de ZiFiT (//zifit.partners.org/ ) als ChopChop ( chopchop.rc.fas.harvard.edu ) websites.

TALEN-bindingsplaatsen gericht op het AGAP011377-gen werden geselecteerd met behulp van de TALE-NT-software 8 en de plaats TCGAAAACACGGGCctggcgccggaaaatTTC TACGTCTGCTAC werd gekozen om te splitsen op AGAP011377 op een plaats die overlapt met de overeenkomstige CRISPR-plaats (onderstreept) in hetzelfde gen (zie Supp. Figuur 7 ). Plasmiden die TALEN tot expressie brengen werden geassembleerd door Golden Gate-klonering zoals beschreven 8 met behulp van de GoldyTALEN-steiger als bestemmingsvector 27 . Vervolgens werd elk TALEN-monomeer gekloneerd in een Anopheles-expressievector onder de expressie van de Vas2-promoter en 3’UTR en werden de FoKI-splitsingsdomeinen gemodificeerd om actief te zijn als obligaat heterodimeer (DD/RR-varianten).

De locatie van de TALEN- en CRISPR-herkenningsplaatsen in relatie tot de coderende sequentie van de doelwitgenen wordt getoond in Supp. Figuur 6 . Elke herkenningssequentie wordt gevolgd door de verplichte PAM-sequentie van 5′-NGG distaal van het gebied van complementariteit in de gRNA-sequentie.

Micro-injectie van muggenembryo’s en selectie van transformanten

Vers gelegde embryo’s van de Anopheles gambiae G3-stam, hierin wildtype genoemd, gekweekt onder standaardomstandigheden van 70% relatieve vochtigheid bij 26 ± 2 °C, werden gebruikt voor micro-injecties zoals elders beschreven 28 .

Voor het genereren van de HDRgfp-dockinglijnen werd het donorconstruct (300 ng/ul) met gebieden van homologie met de relevante doellocus geïnjecteerd samen met het relevante CRISPR-plasmide (300 ng/ul) voor AGAP007280 (p16501) en AGAP005958 (p16505) of, voor AGAP011377, plasmiden die de linker en rechter monomeren van de TALEN tot expressie brengen (elk met 300 ng/ul). Overlevende G 0 -individuen werden gekruist met wildtype en positieve transformanten werden onder fluorescentiemicroscopie geïdentificeerd als GFP+-larven onder de G 1 – nakomelingen.

Voor de recombinase-gemedieerde cassette-uitwisselingsreacties werd een mix met het relevante CRISPR-plasmide (200 ng/ul) en 400 ng/ul vasa::integrase-helperplasmide 29 geïnjecteerd in embryo’s van de HDRgfp-dockinglijnen. Nakomelingen van de uitkruising van overlevende Go  individuen met wildtype werden gescreend op de aanwezigheid van RFP en de afwezigheid van GFP, hetgeen indicatief zou moeten zijn voor een geslaagde cassette-uitwisseling.

Inperking van gene drive-muggen

Alle muggen werden gehuisvest op Imperial College London in een insectenkast die voldoet aan Arthropod Containment Guidelines Level 2 30 . Al het GM-werk werd uitgevoerd onder institutioneel goedgekeurde bioveiligheids- en GM-protocollen. Met name genetisch gemodificeerde muggen die constructies bevatten met het potentieel om gene drive te vertonen, werden gehuisvest in speciale cabines, gescheiden door ten minste 6 deuren van de externe omgeving en waarvoor twee niveaus van toegang met een beveiligingskaart nodig waren. Bovendien vanwege de ligging in een stad met een noordelijk gematigd klimaat, Anopheles gambiaemuggen gehuisvest in de insectenkast zijn ook ecologisch ingeperkt. De fysieke en ecologische inperking van het insect is in overeenstemming met de richtlijnen die zijn uiteengezet in een recent commentaar waarin wordt opgeroepen tot waarborgen bij de studie van synthetische gene drive-technologieën 18 .

Moleculaire bevestiging van gentargeting en recombinase-gemedieerde cassette-uitwisseling

Om moleculair de succesvolle integratie van docking- of CRISPR h -constructen in hun genomische doelplaats te bevestigen, werd genomisch DNA geëxtraheerd met behulp van de Wizard Genomic DNA-zuiveringskit (Promega) van respectievelijk GFP+ of RFP+ G1- muggen . Koppelingsplaatsen werden ondervraagd door PCR met behulp van primers die het koppelingsconstruct binden, 5’GFP-R (TGAACAGCTCCTCGCCCTTG) en 3’GFP-F (GCCCTGAGCAAAGACCCCAA) met primers die het genoom binden buiten de homologie-armen (zoals afgebeeld in Supp. Figuur 1): AGAP11377 met DL-11377-F (GGGTGTTAACGTTCCGCCTA) en DL-11377-R (ACCCAAGACCACCCAAAGAC), AGAP005958 met DL-5958-F1 (CGGACACGCGGAAGTCTGAA) en DL-5958-R1 (CGACTTTCCCGGAACATTTACCA) en AGAP007280 met DL-7280-F1 (AGCACGTGCCGGCTAAAGCT) en DL-7280-R1 (GCCACACCAGCAACAGCCTTATC). Om een ​​korter amplicon te produceren dat op betrouwbare wijze zowel het wild-type allel als het hdrGFP-allel kan amplificeren in dezelfde PCR-reactie (bijv.Figuur 1) de volgende primerparen werden gebruikt: AGAP011377 (Seq-11377-F (AACCGACAGTCCATCCTTGT) en Seq-11377-R (GAGCGTCTTTCGACCTGTTC)); AGAP007280 (Seq-7280-F (GCACAAATCCGATCGTGACA) en Seq-7280-R (CAGTGGCAGTTCCGTAGAGA)); AGAP005958 (Seq-5958-F (GCACTCGTCCGCGTTCTGAA) en Seq-5958-R (TTTGTGCTGGTGTCCGCGCT)).

Succesvolle cassette-uitwisseling van CRISPR h – allelen werd ondervraagd door PCR met behulp van primers die het CRISPR h -construct binden, RFP2q-F (GTGCTGAAGGGCGAGATCCACA) en hCas9-F7 (CGGCGAACTGCAGAAGGGAA) met primers die het genoom binden: AGAP011377 met behulp van Seq-5958-F en Seq-5958- R, AGAP005958 met Seq-5958-F en Seq-5958-R, en AGAP007280 met Seq-7280-F en Seq-7280-R.

Moleculaire bevestiging van CRISPR-activiteit op doelloci

Om de activiteit van CRISPR op de doellocus moleculair te beoordelen, werd de doellocatie gesequenced in die nakomelingen (RFP-) die blijkbaar geen CRISPR-homing-allel van een hemizygote RFP+-ouder ontvingen. Genomisch DNA werd geëxtraheerd met behulp van de Wizard Genomic DNA-zuiveringskit (Promega). Amplicons 2,5 kb aan weerszijden van de CRISPR h -doellocatie in AGAP011377, AGAP005958 en AGAP007280 werden geamplificeerd met Phusion HF-polymerase (Thermo Scientific) met behulp van Seq-11377-F en Seq-11377-R, Seq-5958-F en Seq-5958- R, en Seq-7280-F en Seq-7280-R primers (hierboven beschreven), respectievelijk. PCR-producten werden gezuiverd (Qiagen PCR-zuiveringskit) en de sequentie werd bepaald met behulp van interne primers, Seq-11377-F2 (TCGCCATGTACGCCACCAAC), Seq-5958-F2 (CTTGCCGCTGCGCAGATGTT) en Seq-7280-F2 (TCCGGTGGACCGTTTGTGTG).

Vruchtbaarheidstesten

Heterozygote “docking line”-individuen werden onderling gekruist om heterozygote en homozygote knock-in mutanten te genereren. Nakomelingen werden gescreend op homozygote of heterozygote knock-in-mutaties door respectievelijk “sterke” of “gemiddelde” intensiteit van GFP-fluorescentie. Mannelijke en vrouwelijke individuen van elke gescreende homozygote en heterozygote klasse werden gedurende 5 dagen gepaard met een gelijk aantal wildtype muggen. Vrouwtjes kregen op de 6e dag bloed op een verdoofde muis en minimaal 40 muggen werden afzonderlijk geïsoleerd in bekers van 300 ml en 3 dagen later mochten ze in een beker van 25 ml, gevuld met water en bekleed met filtreerpapier, liggen .. Voor elk vrouwtje werden eieren en larven geteld en werden 16 larven gescreend op GFP-expressie met behulp van een Nikon omgekeerde fluorescentiemicroscoop (Eclipse TE200) om ouderlijke hetero/homozygositeit op de HDR-locus te bevestigen. Heterozygoten werden bevestigd door de aanwezigheid van GFP-nageslacht. Vrouwtjes die geen larven gaven, werden ontleed en onder microscopie gecontroleerd op de aanwezigheid van sperma in hun spermathecae. Degenen die niet gepaard waren, werden uitgesloten van de fenotypische analyse.

Om HDR-hetero/homozygositeit te bevestigen bij transgene vrouwtjes die werden gepaard maar geen nakomelingen konden geven, werd een PCR uitgevoerd over de HDR-locus met behulp van een primerpaar dat is ontworpen om zowel het wildtype allel (1 kb) als het HDR+ allel (2,5 kb) te amplificeren. De volgende primerparen werden gebruikt voor de 3 genen: AGAP011377 met behulp van Seq-11377-F (AACCGACAGTCCATCCTTGT) en Seq-11377-R (GAGCGTCTTTCGACCTGTTC), AGAP005958 met behulp van Seq-5958-F (GCACTCGTCCGCGTTCTGAA) en Seq-5958-R (TTTGTGCTGGTGTCCGCGCT) en AGAP007280 met behulp van Seq-7280-F (GCACAAATCCGATCGTGACA) en Seq-7280-R (CAGTGGCAGTTCCGTAGAGA).

Vruchtbaarheidstesten werden uitgevoerd met behulp van CRISPR h -hemizygoten die in wezen hetzelfde zijn als de “docking line”-fenotype-assays, met de uitzondering dat 50 nakomelingen van elke ouder werden gescreend op de aanwezigheid van een RFP-gekoppeld CRISPR h – allel om de frequentie van CRISPR h -overdracht te beoordelen.

Ethische uitspraak

Al het dierenwerk werd uitgevoerd volgens de UK Home Office Regulations en goedgekeurd onder Home Office License PPL 70/6453.

Kooi experimenten

L1-muggenlarven die heterozygoot waren voor het CRISPRh- allel op AGAP007280 werden binnen 12 uur na onthulling gemengd met een gelijk aantal wildtype larven van dezelfde leeftijd in kweekbakken met een dichtheid van 200 per bak (in ongeveer 1 liter kweekwater). De gemengde populatie werd gebruikt om twee startkooien met elk 600 volwassen muggen te bezaaien. Vier generaties lang werd elke kooi na 5 dagen paren gevoederd en werd 48 uur na de bloedmaaltijd een eierkom in de kooi geplaatst om ‘s nachts ovipositie mogelijk te maken. Nadat volledige eclosion was toegestaan, werd een willekeurige steekproef van nakomelingen onder fluorescentiemicroscopie gescoord op de aanwezigheid of afwezigheid van het RFP-gekoppelde CRISPR h – allel, vervolgens samen gekweekt in dezelfde trays en 600 werden gebruikt om de volgende generatie te bevolken.​

Aanvullende tabel 3

Logistieke regressiecoëfficiënten

Samenvatting van de redactie

De ontwikkeling van een op CRISPR/Cas9 gebaseerd gene drive-systeem in Anopheles gambiae , de belangrijkste vector voor de malariaparasiet, maakt de weg vrij voor de bestrijding van dit plaaginsect.

Aanvullend materiaal

Aanvullende figuur 1-13

Klik hier om te bekijken. (37M, pdf)

Aanvullende tabel 1

Klik hier om te bekijken. (29K, docx)

Dankbetuigingen

We zijn Chris Bamikole, Ann Hall en Danica Fabrigar dankbaar voor experimentele hulp en Philippos Papathanos en Silke Fuchs voor nuttige discussies. Dit werk werd ondersteund door een subsidie ​​van de Foundation for the National Institutes of Health via het Vector-Based Control of Transmission: Discovery Research (VCTR)-programma van het Grand Challenges in Global Health-initiatief van de Bill & Melinda Gates Foundation en door de Europese Onderzoeksraad in het kader van het Zevende Kaderprogramma van de Europese Unie ERC Grant No. 335724 naar NW.

Voetnoten

Mede mogelijk gemaakt door

Bijdragen van de auteurAH, RG, KK, AS, CS, DK en MG voerden de experimenten uit. EM en NW ontwikkelden muggenreagentia. DB, SR, TN en AB ontwikkelden het logistische regressiemodel. AB deed de experimentele modellering. AH, RG, NW en TN ontwierpen de experimenten. AH, AC, AB en TN analyseerden de data. AH, AC en TN schreven de krant.

Verklaring concurrerende financiële belangen

Er zijn geen concurrerende financiële belangen

Artikel informatie

Nat Biotechnol. Auteur manuscript; beschikbaar in PMC 2016 1 juli.

Gepubliceerd in definitief bewerkte vorm als:

Nat Biotechnol. januari 2016; 34(1): 78-83.

Online gepubliceerd op 7 december 2015. doi:  10.1038/nbt.3439

PMCID: PMC4913862

EMSID: EMS66155PMID: 

26641531

Andrew Hammond , 

Roberto Galizi , 

Kyros Kyrou , 

Alekos Simoni , 

Carla Siniscalchi , 

Dimitris Katsanos , 

Matthew Gribble , 

Dean Baker , 

Eric Marois , 

Steven Russell , 

Austin Burt , 

Nikolai Windbichler , 

1, Andrea Crisanti , 

1, * en 

Tony Nolan 1, *

1 Afdeling Levenswetenschappen, Imperial College London, SW7 2AZ, VK

2 Dipartimento di Medicina Sperimentale Via Gambuli, Centro di Genomica Funzionale, Universiteit van Perugia, 06132 Perugia, Italië

3 Afdeling Genetica, Universiteit van Cambridge, CB2 3EH, VK

4 INSERM U963, CNRS UPR9022, Université de Strasbourg, Institut de Biologie Moléculaire et Cellulaire, 67084 Straatsburg, Frankrijk

* corresponderende auteurs: ( 

ku.ca.lairepmi@relhcibdniw.n ; 

ku.ca.lairepmi@itnasirc.a ; 

ku.ca.lairepmi@nalon.t )

copyright meldingGebruikers kunnen tekst en datamining van de inhoud in dergelijke documenten bekijken, afdrukken, kopiëren en downloaden ten behoeve van academisch onderzoek, altijd onderworpen aan de volledige gebruiksvoorwaarden: 

http://www.nature.com/authors/editorial_policies /license.html#termsDe laatste bewerkte versie van dit artikel van de uitgever is beschikbaar op 

Nat Biotechnol

Referenties

1. 

Burt A. Plaatsspecifieke zelfzuchtige genen als hulpmiddelen voor de controle en genetische manipulatie van natuurlijke populaties. Proc Biol Sci. 2003; 270 : 921-928. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]2. 

Windbichler N, et al. Een synthetisch homing endonuclease-gebaseerd gene drive-systeem in de menselijke malariamug. Natuur. 2011; 473 : 212-215. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]3. 

Simoni A, et al. Ontwikkeling van synthetische zelfzuchtige elementen op basis van modulaire nucleasen in Drosophila melanogaster. Nucleïnezuren Res. 2014; 42 :7461-7472. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]4. 

Fu Y, Sander JD, Reyon D, Cascio VM, Joung JK. Verbetering van CRISPR-Cas-nucleasespecificiteit met behulp van afgeknotte gids-RNA’s. Nat Biotechnol. 2014; 32 : 279-284. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]5. 

Hsu PD, et al. DNA-targetingspecificiteit van RNA-geleide Cas9-nucleasen. Nat Biotechnol. 2013; 31 :827-832. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]6. 

Jinek M, et al. Een programmeerbare dual-RNA-geleide DNA-endonuclease in adaptieve bacteriële immuniteit. Wetenschap. 2012; 337 : 816-821. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]7. 

Esvelt KM, Smidler AL, Catteruccia F, Church GM. Betreffende RNA-geleide gene drives voor de verandering van wilde populaties. Elf. 2014: e03401. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]8. 

DiCarlo JE, Chavez A, Dietz SL, Esvelt KM, Church GM. Bescherming van CRISPR-Cas9-genaandrijvingen in gist. Nat Biotechnol. 2015 [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]9. 

Gantz VM, Bier E. Genoombewerking. De mutagene kettingreactie: een methode om heterozygote naar homozygote mutaties om te zetten. Wetenschap. 2015; 348 : 442-444. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]10. 

Deredec A, Burt A, Godfray HC. De populatiegenetica van het gebruik van homing endonuclease-genen bij vector- en plaagbestrijding. Genetica. 2008; 179 : 2013-2026. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]11. 

Baker DA, et al. Een uitgebreide genexpressie-atlas van geslachts- en weefselspecificiteit in de malariavector, Anopheles gambiae. BMC Genomics. 2011; 12 :296. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]12. 

Giraldo-Calderon GI, et al. VectorBase: een bijgewerkte bio-informatica-bron voor ongewervelde vectoren en andere organismen die verband houden met ziekten bij de mens. Nucleïnezuren Res. 2015; 43 :D707-713. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]13. 

Claycomb JM, Benasutti M, Bosco G, Fenger DD, Orr-Weaver TL. Genamplificatie als ontwikkelingsstrategie: isolatie van twee ontwikkelingsamplicons in Drosophila. Ontwikkel cel. 2004; 6 : 145-155. [ PubMed ] [ Google Scholar ]14. 

Hong CC, Hashimoto C. Het maternale nudel-eiwit van Drosophila heeft twee verschillende rollen die belangrijk zijn voor de embryogenese. Genetica. 1996; 143 : 1653-1661. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]15. 

Bateman JR, Lee AM, Wu CT. Plaatsspecifieke transformatie van Drosophila via phiC31 integrase-gemedieerde cassette-uitwisseling. Genetica. 2006; 173 : 769-777. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]16. 

Papathanos PA, Windbichler N, Menichelli M, Burt A, Crisanti A. Het vasa-regulerende gebied bemiddelt de kiembaanexpressie en maternale overdracht van eiwitten in de malariamug Anopheles gambiae: een veelzijdig hulpmiddel voor genetische controlestrategieën. BMC Mol Biol. 2009; 10:65 . [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]17. 

Konet DS, et al. RNA met een korte haarspeld tot expressie gebracht door polymerase III-promoters bemiddelt RNA-interferentie in muggencellen. Insect Mol Biol. 2007; 16 : 199-206. [ PubMed ] [ Google Scholar ]18. 

Akbari OS, et al. BIOSVEILIGHEID. Borgen van gene drive experimenten in het laboratorium. Wetenschap. 2015; 349 : 927-929. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]19. 

Bae S, Kweon J, Kim HS, Kim JS. Op microhomologie gebaseerde keuze van Cas9-nuclease-doelwitplaatsen. Natuur methoden. 2014; 11 : 705-706. [ PubMed ] [ Google Scholar ]20. 

Poort F, Chen HM, Lee T, Bullock SL. Geoptimaliseerde CRISPR/Cas-tools voor efficiënte kiembaan- en somatische genoomengineering in Drosophila. Proc Natl Acad Sci VS A. 2014; 111 :E2967–2976. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]21. 

Thomas DD, Donnelly CA, Wood RJ, Alphey LS. Beheersing van insectenpopulatie met behulp van een dominant, onderdrukbaar, dodelijk genetisch systeem. Wetenschap. 2000; 287 : 2474-2476. [ PubMed ] [ Google Scholar ]22. 

Deredec A, Godfray HC, Burt A. Vereisten voor effectieve malariabestrijding met homing endonuclease-genen. Proc Natl Acad Sci VS A. 2011; 108 :E874-880. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]23. 

Chintapalli VR, Wang J, Dow JA. FlyAtlas gebruiken om betere Drosophila melanogaster-modellen van ziekten bij de mens te identificeren. Nat Genet. 2007; 39 : 715-720. [ PubMed ] [ Google Scholar ]24. 

Yanai I, et al. Genoombrede midrange-transcriptieprofielen onthullen relaties op expressieniveau in de specificatie van menselijk weefsel. Bio-informatica. 2005; 21 :650-659. [ PubMed ] [ Google Scholar ]25. 

Drysdale RA, Crosby MA, FlyBase C. FlyBase: genen en genmodellen. Nucleïnezuren Res. 2005; 33 :D390-395. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]26. 

Hwang WY, et al. Efficiënte genoombewerking in zebravissen met behulp van een CRISPR-Cas-systeem. Nat Biotechnol. 2013; 31 :227-229. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]27. 

Carlson DF, et al. Efficiënte door TALEN gemedieerde gen-knock-out bij vee. Proc Natl Acad Sci VS A. 2012; 109 : 17382-17387. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]28. 

Fuchs S, Nolan T, Crisanti A. Mosquito-transgene technologieën om de overdracht van Plasmodium te verminderen. Methoden Mol Biol. 2013; 923 : 601-622. [ PubMed ] [ Google Scholar ]29. 

Volohonsky G, et al. Hulpmiddelen voor Anopheles gambiae Transgenese. G3 (Bethesda) 2015; 5 :1151-1163. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]30. 

Scott TW. Inperking van ziektevectoren van geleedpotigen. ILAR J. 2005; 46 : 53-61. [ PubMed ] [ Google Scholar ]31. 

Thailayil J, Magnusson K, Godfray HC, Crisanti A, Catteruccia F. Zaadloze mannetjes lokken grootschalige vrouwelijke reacties uit op paring in de malariamug Anopheles gambiae. Proc Natl Acad Sci VS A. 2011; 108 :13677-13681. [ PMC gratis artikel ] [ PubMed ] [ Google Scholar ]

Vertel ons wat u denkt!

Laat een reactie achter

Het e-mailadres wordt niet gepubliceerd. Vereiste velden zijn gemarkeerd met *


            

            

                        
            
            
assignment_turned_in Registrations
No Registration form is selected.
(Click on the star on form card to select)
Please login to view this page.
Please login to view this page.
Please login to view this page.